Transcript: Human NM_001286808.2

Homo sapiens proline rich coiled-coil 1 (PRRC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PRRC1 (133619)
Length:
2746
CDS:
158..1546

Additional Resources:

NCBI RefSeq record:
NM_001286808.2
NBCI Gene record:
PRRC1 (133619)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168740 GCTCCCTATATCAAATCTGGA pLKO.1 902 CDS 100% 2.640 3.696 N PRRC1 n/a
2 TRCN0000364887 GGGCTATGCAGCTGGATTAAA pLKO_005 1057 CDS 100% 15.000 10.500 N PRRC1 n/a
3 TRCN0000250400 CTGGAGGTGAACTGGATATTG pLKO_005 918 CDS 100% 13.200 9.240 N Prrc1 n/a
4 TRCN0000364921 CTGGAGGTGAACTGGATATTG pLKO_005 918 CDS 100% 13.200 9.240 N PRRC1 n/a
5 TRCN0000258062 GGAAGCTGGACAGTCCAATAT pLKO_005 1021 CDS 100% 13.200 9.240 N Prrc1 n/a
6 TRCN0000364922 GGAAGCTGGACAGTCCAATAT pLKO_005 1021 CDS 100% 13.200 9.240 N PRRC1 n/a
7 TRCN0000376438 TTGGTTCAACTTATGACATTA pLKO_005 561 CDS 100% 13.200 9.240 N PRRC1 n/a
8 TRCN0000250403 ACCACATCAGCCATTACTTTC pLKO_005 713 CDS 100% 10.800 7.560 N Prrc1 n/a
9 TRCN0000369805 ACCACATCAGCCATTACTTTC pLKO_005 713 CDS 100% 10.800 7.560 N PRRC1 n/a
10 TRCN0000167996 CCCACCACTTGTTACTTCTAT pLKO.1 406 CDS 100% 5.625 3.938 N PRRC1 n/a
11 TRCN0000173024 CCTTCGGTAATCCTCCTGTAT pLKO.1 459 CDS 100% 4.950 3.465 N PRRC1 n/a
12 TRCN0000167859 GTGACCTCAAATAAAGAAGTA pLKO.1 941 CDS 100% 4.950 3.465 N PRRC1 n/a
13 TRCN0000172535 GCACATGGCATTTACTGGGAT pLKO.1 1393 CDS 100% 2.640 1.848 N PRRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10476 pDONR223 100% 93.9% 94.1% None (many diffs) n/a
2 ccsbBroad304_10476 pLX_304 0% 93.9% 94.1% V5 (many diffs) n/a
3 TRCN0000470818 GATCGAAGCCCTATTGCATAAACA pLX_317 29.5% 93.9% 94.1% V5 (many diffs) n/a
Download CSV