Transcript: Human XM_011520426.3

PREDICTED: Homo sapiens tripartite motif containing 5 (TRIM5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM5 (85363)
Length:
2018
CDS:
279..1211

Additional Resources:

NCBI RefSeq record:
XM_011520426.3
NBCI Gene record:
TRIM5 (85363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433813 AGAAGTCCATGCTAGACAAAG pLKO_005 409 CDS 100% 10.800 7.560 N TRIM5 n/a
2 TRCN0000005896 CCTGAGAACATACGGCCTAAT pLKO.1 468 CDS 100% 10.800 7.560 N TRIM5 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1284 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1284 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09257 pDONR223 100% 78.1% 74.2% None (many diffs) n/a
2 ccsbBroad304_09257 pLX_304 0% 78.1% 74.2% V5 (many diffs) n/a
3 TRCN0000473045 AAAAAAGTTGCCCGATGAACTGAA pLX_317 28.1% 78.1% 74.2% V5 (many diffs) n/a
Download CSV