Transcript: Human NM_002253.3

Homo sapiens kinase insert domain receptor (KDR), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
KDR (3791)
Length:
5849
CDS:
303..4373

Additional Resources:

NCBI RefSeq record:
NM_002253.3
NBCI Gene record:
KDR (3791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002253.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196398 GATGAAAGTTACCAGTCTATT pLKO.1 918 CDS 100% 13.200 18.480 N KDR n/a
2 TRCN0000199129 CGCTGACATGTACGGTCTATG pLKO.1 1627 CDS 100% 10.800 15.120 N KDR n/a
3 TRCN0000001688 CTTTACTATTCCCAGCTACAT pLKO.1 854 CDS 100% 4.950 6.930 N KDR n/a
4 TRCN0000001685 GCGGCACGAAATATCCTCTTA pLKO.1 3390 CDS 100% 4.950 6.930 N KDR n/a
5 TRCN0000195185 CATTTGAAGATATCCCGTTAG pLKO.1 4015 CDS 100% 6.000 4.800 N KDR n/a
6 TRCN0000197167 GACTGGCTTTGGCCCAATAAT pLKO.1 480 CDS 100% 15.000 10.500 N KDR n/a
7 TRCN0000195236 CTGGAATGAATACCCTCATAT pLKO.1 5247 3UTR 100% 13.200 9.240 N KDR n/a
8 TRCN0000001687 GTGCTGTTTCTGACTCCTAAT pLKO.1 5043 3UTR 100% 10.800 7.560 N KDR n/a
9 TRCN0000001686 AGGCTAATACAACTCTTCAAA pLKO.1 433 CDS 100% 5.625 3.938 N KDR n/a
10 TRCN0000001689 GTGGTCTCTCTGGTTGTGTAT pLKO.1 1536 CDS 100% 4.950 3.465 N KDR n/a
11 TRCN0000023748 GCATCTCATCTGTTACAGCTT pLKO.1 3311 CDS 100% 2.640 1.848 N Kdr n/a
12 TRCN0000195082 CCACAGATCATGTGGTTTAAA pLKO.1 2388 CDS 100% 1.500 1.050 N KDR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002253.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14684 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14684 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471918 CTATACACTAATTATCGGTAATCG pLX_317 12% 100% 100% V5 n/a
4 TRCN0000487801 GGTCAACACTCCCGGCTGCAGGCC pLX_317 7% 99.9% 99.9% V5 (not translated due to prior stop codon) 889G>A n/a
5 TRCN0000492241 TTATACGGTATATTGTTACCGGTG pLX_317 4.9% 99.9% 99.8% V5 889G>A;4068_4069insG n/a
6 TRCN0000489487 GTTCCAAAAGCTGGTGCGCGAGGT pLX_317 25% 40.6% 40.6% V5 (not translated due to prior stop codon) 1_2415del n/a
Download CSV