Transcript: Human NM_001145025.2

Homo sapiens ER degradation enhancing alpha-mannosidase like protein 2 (EDEM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
EDEM2 (55741)
Length:
1773
CDS:
79..1704

Additional Resources:

NCBI RefSeq record:
NM_001145025.2
NBCI Gene record:
EDEM2 (55741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342980 CAAACGGAGCAGGTCGAAATT pLKO_005 1491 CDS 100% 13.200 6.600 Y EDEM2 n/a
2 TRCN0000369425 CACTTCGGCCAGAACTTATTG pLKO_005 1070 CDS 100% 13.200 6.600 Y EDEM2 n/a
3 TRCN0000055969 CCTAGAGTATAACAAAGCCAT pLKO.1 807 CDS 100% 2.640 1.320 Y EDEM2 n/a
4 TRCN0000298248 CCTAGAGTATAACAAAGCCAT pLKO_005 807 CDS 100% 2.640 1.320 Y EDEM2 n/a
5 TRCN0000055970 GAAACAAACATTCGAGTGGTA pLKO.1 316 CDS 100% 2.640 1.320 Y EDEM2 n/a
6 TRCN0000055968 GCTTCAGGATAAGAAGCTCAT pLKO.1 777 CDS 100% 0.405 0.203 Y EDEM2 n/a
7 TRCN0000055972 GCCATATGGAACAGTGAACTT pLKO.1 480 CDS 100% 0.000 0.000 Y EDEM2 n/a
8 TRCN0000286597 GCCATATGGAACAGTGAACTT pLKO_005 480 CDS 100% 0.000 0.000 Y EDEM2 n/a
9 TRCN0000055971 GCTCCCGGAATTCTACAACAT pLKO.1 1011 CDS 100% 0.000 0.000 Y EDEM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08575 pDONR223 100% 93.5% 93.4% None 104_105ins111;1255G>A n/a
2 ccsbBroad304_08575 pLX_304 0% 93.5% 93.4% V5 104_105ins111;1255G>A n/a
3 TRCN0000467820 CCCCACCAGAACCCCCGATCTGTC pLX_317 17.2% 93.5% 93.4% V5 104_105ins111;1255G>A n/a
Download CSV