Transcript: Human NM_198718.2

Homo sapiens prostaglandin E receptor 3 (PTGER3), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PTGER3 (5733)
Length:
1971
CDS:
240..1496

Additional Resources:

NCBI RefSeq record:
NM_198718.2
NBCI Gene record:
PTGER3 (5733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357982 TGGTCTCCGCTCCTGATAATG pLKO_005 1122 CDS 100% 13.200 18.480 N PTGER3 n/a
2 TRCN0000014157 CGGGACTAGCTCTTCGCATAA pLKO.1 890 CDS 100% 10.800 7.560 N PTGER3 n/a
3 TRCN0000014155 CCTTGGGTTTACCTGCTGTTA pLKO.1 1266 CDS 100% 4.950 3.465 N PTGER3 n/a
4 TRCN0000014156 GCTCCTGATAATGATGTTGAA pLKO.1 1130 CDS 100% 4.950 3.465 N PTGER3 n/a
5 TRCN0000014154 GCAGAAAGAATGCAACTTCTT pLKO.1 1202 CDS 100% 0.495 0.347 N PTGER3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488834 GAAATTTGACATTTGATATATTTA pLX_317 32% 90.3% 84.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11069 pDONR223 100% 89.9% 87.7% None (many diffs) n/a
3 ccsbBroad304_11069 pLX_304 0% 89.9% 87.7% V5 (many diffs) n/a
4 TRCN0000471285 TCCTGTTCCCTAGCCTTGCCGCAA pLX_317 33.6% 89.9% 87.7% V5 (many diffs) n/a
5 TRCN0000489013 GTATTATTGAATAACAAGGGTCTC pLX_317 28.4% 89.8% 86.4% V5 (many diffs) n/a
6 TRCN0000489294 GACGCGATCCTTCCGCAAACTACC pLX_317 29% 89.3% 86.5% V5 (many diffs) n/a
7 ccsbBroadEn_15551 pDONR223 0% 89.1% 86.7% None (many diffs) n/a
8 ccsbBroad304_15551 pLX_304 0% 89.1% 86.7% V5 (many diffs) n/a
9 TRCN0000470039 TCTTAGTTCCCACGTTCCCGAAGC pLX_317 34.5% 89.1% 86.7% V5 (many diffs) n/a
10 TRCN0000487757 CACGCCTCTGGACTTTCCCAGTCA pLX_317 21.6% 89.1% 86.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV