Transcript: Human NM_001199280.2

Homo sapiens hyaluronan synthase 3 (HAS3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HAS3 (3038)
Length:
4191
CDS:
136..1797

Additional Resources:

NCBI RefSeq record:
NM_001199280.2
NBCI Gene record:
HAS3 (3038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415992 TTGGCTACCGAACTAAGTATA pLKO_005 1115 CDS 100% 13.200 18.480 N HAS3 n/a
2 TRCN0000045409 CCATTGCTACCATCAACAAAT pLKO.1 1505 CDS 100% 13.200 9.240 N HAS3 n/a
3 TRCN0000437367 GGCTGGCCTACACAGCTTATT pLKO_005 1616 CDS 100% 13.200 9.240 N HAS3 n/a
4 TRCN0000045412 CTTCCTCATTGCCACGGTTAT pLKO.1 1308 CDS 100% 10.800 7.560 N HAS3 n/a
5 TRCN0000419791 GTTGTGCTAAACCAAGTTAAG pLKO_005 2097 3UTR 100% 10.800 7.560 N HAS3 n/a
6 TRCN0000045411 ACCTGCTCATTCAGAGCCTTT pLKO.1 299 CDS 100% 4.050 2.835 N HAS3 n/a
7 TRCN0000045408 GCTCTACAACTCTCTGTGGTT pLKO.1 1230 CDS 100% 2.640 1.848 N HAS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06352 pDONR223 100% 48.1% 45.6% None (many diffs) n/a
2 ccsbBroad304_06352 pLX_304 0% 48.1% 45.6% V5 (many diffs) n/a
3 TRCN0000481493 AGATTCATTAACACTGCTTTCTAT pLX_317 44.2% 48.1% 45.6% V5 (many diffs) n/a
Download CSV