Transcript: Human NM_001017366.3

Homo sapiens complement component 4 binding protein beta (C4BPB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
C4BPB (725)
Length:
957
CDS:
138..893

Additional Resources:

NCBI RefSeq record:
NM_001017366.3
NBCI Gene record:
C4BPB (725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371549 GTGAAGACAGGTACTACTTAG pLKO_005 628 CDS 100% 10.800 15.120 N C4BPB n/a
2 TRCN0000057157 GAGAGTAAGAACCTCTGCGAA pLKO.1 765 CDS 100% 2.640 2.112 N C4BPB n/a
3 TRCN0000057154 CCAGTGGACAATAGCATATTT pLKO.1 216 CDS 100% 15.000 10.500 N C4BPB n/a
4 TRCN0000371550 GGAGAACTTTATGCAACAATT pLKO_005 791 CDS 100% 13.200 9.240 N C4BPB n/a
5 TRCN0000057153 CCTGTGAATGTAAGTGACAAA pLKO.1 420 CDS 100% 4.950 3.465 N C4BPB n/a
6 TRCN0000057155 GAAGGAAATAACTTCACCTTA pLKO.1 585 CDS 100% 4.950 3.465 N C4BPB n/a
7 TRCN0000057156 GTCTGCAAGTTGATCCAGGAA pLKO.1 702 CDS 100% 2.640 1.848 N C4BPB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00186 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00186 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469754 CAAACCACCATGTCCTCTCACAGA pLX_317 47.6% 100% 100% V5 n/a
Download CSV