Transcript: Human XR_001753798.2

PREDICTED: Homo sapiens armadillo repeat containing 6 (ARMC6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC6 (93436)
Length:
2916
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753798.2
NBCI Gene record:
ARMC6 (93436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129254 CGACGTGAAAGATGCTATTGT pLKO.1 1936 3UTR 100% 5.625 7.875 N ARMC6 n/a
2 TRCN0000130155 CATTGTAAAGACGGCACCTAA pLKO.1 505 3UTR 100% 4.950 3.465 N ARMC6 n/a
3 TRCN0000129190 CCCTTCACAATGAGAAGTGTT pLKO.1 2464 3UTR 100% 4.950 3.465 N ARMC6 n/a
4 TRCN0000129621 CATCATCTTCACTGCCTGGAA pLKO.1 706 3UTR 100% 2.640 1.848 N ARMC6 n/a
5 TRCN0000129339 CCATGCCAAGATGATTGTGCA pLKO.1 1084 3UTR 100% 2.640 1.848 N ARMC6 n/a
6 TRCN0000129211 CTCTGCTCCTTGTCTTTCTTA pLKO.1 2786 3UTR 100% 5.625 3.375 N ARMC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04602 pDONR223 100% 48.9% None 1_367del;1313_1882del;2366_2916del n/a
2 ccsbBroad304_04602 pLX_304 0% 48.9% V5 1_367del;1313_1882del;2366_2916del n/a
3 TRCN0000476466 GTCCTCGCTTCACTGCGTAAACGG pLX_317 18% 48.9% V5 1_367del;1313_1882del;2366_2916del n/a
Download CSV