Transcript: Human XR_002957464.1

PREDICTED: Homo sapiens ankyrin repeat domain 10 (ANKRD10), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD10 (55608)
Length:
3627
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957464.1
NBCI Gene record:
ANKRD10 (55608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429849 GCATGAGTAGGGCTTACTAAG pLKO_005 2696 3UTR 100% 10.800 15.120 N ANKRD10 n/a
2 TRCN0000442637 CACGAATGGCGACACAGAAGA pLKO_005 1987 3UTR 100% 4.950 6.930 N ANKRD10 n/a
3 TRCN0000147077 CCGTATCGAATACATTGACAA pLKO.1 2073 3UTR 100% 4.950 6.930 N ANKRD10 n/a
4 TRCN0000437658 ACCGGATTGTGAGGGTGAAAC pLKO_005 497 3UTR 100% 10.800 8.640 N ANKRD10 n/a
5 TRCN0000430695 CTGATGCCAATCTCAACATTG pLKO_005 2775 3UTR 100% 10.800 8.640 N ANKRD10 n/a
6 TRCN0000438147 CGAGCATTCCAAGTCCGTGAA pLKO_005 2449 3UTR 100% 4.050 3.240 N ANKRD10 n/a
7 TRCN0000429731 CATATTAGTGTGGGAACAAAT pLKO_005 1880 3UTR 100% 13.200 9.240 N ANKRD10 n/a
8 TRCN0000436472 AGCTAGAACTGAAGCTCAAAG pLKO_005 1945 3UTR 100% 10.800 7.560 N ANKRD10 n/a
9 TRCN0000437289 GAGAAGACCCTGAGAGCTAAC pLKO_005 2270 3UTR 100% 6.000 4.200 N ANKRD10 n/a
10 TRCN0000443848 GGAGTCCAAGTAGCTGCATAG pLKO_005 2322 3UTR 100% 6.000 4.200 N ANKRD10 n/a
11 TRCN0000420521 AGGGTTCTCTCTGCATTAGTG pLKO_005 2235 3UTR 100% 4.950 3.465 N ANKRD10 n/a
12 TRCN0000180643 CCAGCTCAGAATACCCATGTA pLKO.1 2576 3UTR 100% 4.950 3.465 N ANKRD10 n/a
13 TRCN0000426369 AGAATGCATCAGTGCCCTTGT pLKO_005 551 3UTR 100% 4.050 2.835 N ANKRD10 n/a
14 TRCN0000150050 CAGAATTGTCATCTGAACCAT pLKO.1 1808 3UTR 100% 3.000 2.100 N ANKRD10 n/a
15 TRCN0000085280 CGGCAAGTTGGAGTGCTTAAT pLKO.1 341 3UTR 100% 13.200 10.560 N Ankrd10 n/a
16 TRCN0000147007 CGAATGTCACAACTTGTACTT pLKO.1 2610 3UTR 100% 4.950 3.960 N ANKRD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12232 pDONR223 100% 18.1% None (many diffs) n/a
2 ccsbBroad304_12232 pLX_304 0% 18.1% V5 (many diffs) n/a
3 TRCN0000471743 GTACTTGCGGGATATGTGTTGCAG pLX_317 68.6% 18.1% V5 (many diffs) n/a
Download CSV