Transcript: Human XR_002957461.1

PREDICTED: Homo sapiens ankyrin repeat domain 10 (ANKRD10), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD10 (55608)
Length:
2662
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957461.1
NBCI Gene record:
ANKRD10 (55608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429849 GCATGAGTAGGGCTTACTAAG pLKO_005 1731 3UTR 100% 10.800 15.120 N ANKRD10 n/a
2 TRCN0000442637 CACGAATGGCGACACAGAAGA pLKO_005 1022 3UTR 100% 4.950 6.930 N ANKRD10 n/a
3 TRCN0000147077 CCGTATCGAATACATTGACAA pLKO.1 1108 3UTR 100% 4.950 6.930 N ANKRD10 n/a
4 TRCN0000437658 ACCGGATTGTGAGGGTGAAAC pLKO_005 497 3UTR 100% 10.800 8.640 N ANKRD10 n/a
5 TRCN0000430695 CTGATGCCAATCTCAACATTG pLKO_005 1810 3UTR 100% 10.800 8.640 N ANKRD10 n/a
6 TRCN0000438147 CGAGCATTCCAAGTCCGTGAA pLKO_005 1484 3UTR 100% 4.050 3.240 N ANKRD10 n/a
7 TRCN0000429731 CATATTAGTGTGGGAACAAAT pLKO_005 915 3UTR 100% 13.200 9.240 N ANKRD10 n/a
8 TRCN0000436472 AGCTAGAACTGAAGCTCAAAG pLKO_005 980 3UTR 100% 10.800 7.560 N ANKRD10 n/a
9 TRCN0000437289 GAGAAGACCCTGAGAGCTAAC pLKO_005 1305 3UTR 100% 6.000 4.200 N ANKRD10 n/a
10 TRCN0000443848 GGAGTCCAAGTAGCTGCATAG pLKO_005 1357 3UTR 100% 6.000 4.200 N ANKRD10 n/a
11 TRCN0000420521 AGGGTTCTCTCTGCATTAGTG pLKO_005 1270 3UTR 100% 4.950 3.465 N ANKRD10 n/a
12 TRCN0000180643 CCAGCTCAGAATACCCATGTA pLKO.1 1611 3UTR 100% 4.950 3.465 N ANKRD10 n/a
13 TRCN0000426369 AGAATGCATCAGTGCCCTTGT pLKO_005 551 3UTR 100% 4.050 2.835 N ANKRD10 n/a
14 TRCN0000150050 CAGAATTGTCATCTGAACCAT pLKO.1 843 3UTR 100% 3.000 2.100 N ANKRD10 n/a
15 TRCN0000085280 CGGCAAGTTGGAGTGCTTAAT pLKO.1 341 3UTR 100% 13.200 10.560 N Ankrd10 n/a
16 TRCN0000147007 CGAATGTCACAACTTGTACTT pLKO.1 1645 3UTR 100% 4.950 3.960 N ANKRD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12232 pDONR223 100% 23.6% None (many diffs) n/a
2 ccsbBroad304_12232 pLX_304 0% 23.6% V5 (many diffs) n/a
3 TRCN0000471743 GTACTTGCGGGATATGTGTTGCAG pLX_317 68.6% 23.6% V5 (many diffs) n/a
Download CSV