Transcript: Human NM_080927.4

Homo sapiens discoidin, CUB and LCCL domain containing 2 (DCBLD2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DCBLD2 (131566)
Length:
6128
CDS:
370..2697

Additional Resources:

NCBI RefSeq record:
NM_080927.4
NBCI Gene record:
DCBLD2 (131566)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080927.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072360 CGGCCAAATCAGTGTTGTAAT pLKO.1 1122 CDS 100% 13.200 18.480 N DCBLD2 n/a
2 TRCN0000072361 CGGATGTCAGTTTATTCCTAA pLKO.1 1710 CDS 100% 4.950 6.930 N DCBLD2 n/a
3 TRCN0000072362 GTGTGGAGCAAGATAAGATAT pLKO.1 1565 CDS 100% 13.200 10.560 N DCBLD2 n/a
4 TRCN0000072358 CGCTTCAGAAAGAGAACTGTT pLKO.1 4331 3UTR 100% 4.950 3.465 N DCBLD2 n/a
5 TRCN0000072359 GCCACCAATTATTGCACGTTT pLKO.1 1632 CDS 100% 4.950 3.465 N DCBLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080927.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13162 pDONR223 100% 92.3% 92.3% None (many diffs) n/a
2 ccsbBroad304_13162 pLX_304 0% 92.3% 92.3% V5 (many diffs) n/a
3 TRCN0000466300 CGGCAGCAAGTCATAGCTCGCCGG pLX_317 16.6% 92.3% 92.3% V5 (many diffs) n/a
Download CSV