Transcript: Human NM_020144.5

Homo sapiens poly(A) polymerase beta (PAPOLB), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PAPOLB (56903)
Length:
4293
CDS:
221..2134

Additional Resources:

NCBI RefSeq record:
NM_020144.5
NBCI Gene record:
PAPOLB (56903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020144.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422128 CATACGAAAGGCGCAGATATT pLKO_005 545 CDS 100% 13.200 10.560 N PAPOLB n/a
2 TRCN0000053199 GCCTTCATCTACTAGCACTAT pLKO.1 1828 CDS 100% 4.950 3.960 N PAPOLB n/a
3 TRCN0000420403 AGCTAGAGGTACTGTTATTAA pLKO_005 2541 3UTR 100% 15.000 10.500 N PAPOLB n/a
4 TRCN0000053202 CGTCAACTCTTGTACGGAAAT pLKO.1 1017 CDS 100% 10.800 7.560 N PAPOLB n/a
5 TRCN0000053201 GCAGTGAATAGTAAGATGTTT pLKO.1 1634 CDS 100% 5.625 3.938 N PAPOLB n/a
6 TRCN0000053200 GCTTGCTATCACACACGAGAT pLKO.1 1255 CDS 100% 4.050 2.835 N PAPOLB n/a
7 TRCN0000053198 GCCAGTTATCAAACTGTGTTT pLKO.1 685 CDS 100% 0.495 0.347 N PAPOLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020144.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08657 pDONR223 100% 99.7% 99.3% None (many diffs) n/a
2 ccsbBroad304_08657 pLX_304 0% 99.7% 99.3% V5 (many diffs) n/a
3 TRCN0000468084 CTTTTCATCAAGCTAGGAGATCAC pLX_317 24.9% 99.7% 99.3% V5 (many diffs) n/a
4 ccsbBroadEn_11570 pDONR223 100% 38.6% 40% None (many diffs) n/a
5 TRCN0000479225 GTACAGGTACTCAAGTAGGGTTCA pLX_317 64.1% 38.6% 40% V5 (many diffs) n/a
Download CSV