Transcript: Human XM_011536024.3

PREDICTED: Homo sapiens branched chain keto acid dehydrogenase E1 subunit beta (BCKDHB), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCKDHB (594)
Length:
3743
CDS:
31..1092

Additional Resources:

NCBI RefSeq record:
XM_011536024.3
NBCI Gene record:
BCKDHB (594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236122 GCTACTGCCATTGCGGAAATT pLKO_005 451 CDS 100% 13.200 18.480 N BCKDHB n/a
2 TRCN0000236120 TACCGGTGTAGATGCTATATT pLKO_005 3072 3UTR 100% 0.000 0.000 N BCKDHB n/a
3 TRCN0000236119 CATTGATCTGAGGACTATAAT pLKO_005 933 CDS 100% 15.000 12.000 N BCKDHB n/a
4 TRCN0000236121 GAACCTAGAGGCTCCTATATC pLKO_005 1151 3UTR 100% 13.200 10.560 N BCKDHB n/a
5 TRCN0000028438 CCTTGGGATGTGGACACAATT pLKO.1 955 CDS 100% 13.200 9.240 N BCKDHB n/a
6 TRCN0000236118 TGATCAACTATTGACCATATA pLKO_005 1264 3UTR 100% 13.200 9.240 N BCKDHB n/a
7 TRCN0000028406 CCATTCTACATCCCAGACAAA pLKO.1 1215 3UTR 100% 4.950 3.465 N BCKDHB n/a
8 TRCN0000028459 CGGAAATTCAGTTTGCAGATT pLKO.1 464 CDS 100% 4.950 3.465 N BCKDHB n/a
9 TRCN0000028468 GAGGAATGTTTCTTGAACCTA pLKO.1 1137 3UTR 100% 3.000 2.100 N BCKDHB n/a
10 TRCN0000028471 CCAGTCTGTAACAAGTGCCTT pLKO.1 252 CDS 100% 2.640 1.584 N BCKDHB n/a
11 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 2072 3UTR 100% 13.200 6.600 Y LRRC74B n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1735 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1735 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00154 pDONR223 100% 89% 87.1% None (many diffs) n/a
2 ccsbBroad304_00154 pLX_304 0% 89% 87.1% V5 (many diffs) n/a
3 TRCN0000470199 GCAAAAATGCCGAGCGGATATGCC pLX_317 29.5% 89% 87.1% V5 (many diffs) n/a
Download CSV