Transcript: Human NM_001353760.2

Homo sapiens CUGBP Elav-like family member 4 (CELF4), transcript variant 68, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CELF4 (56853)
Length:
3411
CDS:
151..1209

Additional Resources:

NCBI RefSeq record:
NM_001353760.2
NBCI Gene record:
CELF4 (56853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074404 CTGCTGCCTATGGTCAGATAA pLKO.1 926 CDS 100% 13.200 9.240 N CELF4 n/a
2 TRCN0000098600 CCTTTGACATATCAGCCAATA pLKO.1 1332 3UTR 100% 10.800 7.560 N Celf4 n/a
3 TRCN0000074406 CGCTGAGCTGATGCAGATGTT pLKO.1 1050 CDS 100% 4.950 3.465 N CELF4 n/a
4 TRCN0000437506 GTGCGCCTTTGTGAAGTACTC pLKO_005 330 CDS 100% 4.050 2.835 N CELF4 n/a
5 TRCN0000423355 ACAAACCTCTCTCTATATATA pLKO_005 1284 3UTR 100% 15.000 9.000 N CELF4 n/a
6 TRCN0000098602 CTGCTGCCTATGGTCAGATTA pLKO.1 926 CDS 100% 13.200 9.240 N Celf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12306 pDONR223 100% 72.3% 71.9% None (many diffs) n/a
2 ccsbBroad304_12306 pLX_304 0% 72.3% 71.9% V5 (many diffs) n/a
3 TRCN0000475751 TGGTAACTGTAACCCGAGGTCTCG pLX_317 17.5% 72.3% 71.9% V5 (many diffs) n/a
Download CSV