Transcript: Human NM_001005751.3

Homo sapiens WASH complex subunit 2A (WASHC2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
WASHC2A (387680)
Length:
4642
CDS:
53..4078

Additional Resources:

NCBI RefSeq record:
NM_001005751.3
NBCI Gene record:
WASHC2A (387680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163697 GCCCATCATAGTGACAATGAA pLKO.1 755 CDS 100% 5.625 3.375 N WASHC2A n/a
2 TRCN0000162875 GCTGATGGTCTTAACTGGATT pLKO.1 4144 3UTR 100% 4.950 2.970 N WASHC2A n/a
3 TRCN0000263952 AGTGGAAGCCAAGTCTATATT pLKO_005 3904 CDS 100% 15.000 7.500 Y WASHC2A n/a
4 TRCN0000370689 GAGTGCCAAGGAGTCATTAAA pLKO_005 2293 CDS 100% 15.000 7.500 Y WASHC2C n/a
5 TRCN0000370753 ACGATGAAGAGGATAACTTAT pLKO_005 1053 CDS 100% 13.200 6.600 Y WASHC2C n/a
6 TRCN0000263954 CCTTGAACCAAAGGATCTATA pLKO_005 568 CDS 100% 13.200 6.600 Y WASHC2A n/a
7 TRCN0000365545 GAAACAAGTGGACGGACTAAT pLKO_005 238 CDS 100% 13.200 6.600 Y WASHC2C n/a
8 TRCN0000263953 GAATCCATTCAAGGTAGTAAA pLKO_005 2810 CDS 100% 13.200 6.600 Y WASHC2A n/a
9 TRCN0000370760 GCCGCACCTGAACCAAGATTT pLKO_005 4001 CDS 100% 13.200 6.600 Y WASHC2C n/a
10 TRCN0000281630 GTCCAATCCACTGCCGATATC pLKO_005 1478 CDS 100% 10.800 5.400 Y WASHC2A n/a
11 TRCN0000282877 TGGATGGGAACCCTAACTTAG pLKO_005 4439 3UTR 100% 10.800 5.400 Y WASHC2A n/a
12 TRCN0000160433 CCATTCAAGGTAGTAAAGAAA pLKO.1 2814 CDS 100% 5.625 2.813 Y WASHC2A n/a
13 TRCN0000344250 CCATTCAAGGTAGTAAAGAAA pLKO_005 2814 CDS 100% 5.625 2.813 Y WASHC2A n/a
14 TRCN0000163901 CCTGACCAGAAGTCTTTGTTA pLKO.1 4416 3UTR 100% 5.625 2.813 Y WASHC2A n/a
15 TRCN0000162206 CTCTCTAATACCCAGTTCATT pLKO.1 317 CDS 100% 5.625 2.813 Y WASHC2A n/a
16 TRCN0000162987 GCTGTGAACTATGGCTTACAA pLKO.1 458 CDS 100% 5.625 2.813 Y WASHC2A n/a
17 TRCN0000344330 GCTGTGAACTATGGCTTACAA pLKO_005 458 CDS 100% 5.625 2.813 Y WASHC2A n/a
18 TRCN0000136995 CCTCTGTTAAGGAGGAGTCTT pLKO.1 1218 CDS 100% 4.950 2.475 Y WASHC2C n/a
19 TRCN0000136398 CGAGAGCAGAAAGAAGTAGAT pLKO.1 416 CDS 100% 4.950 2.475 Y WASHC2C n/a
20 TRCN0000162874 GATCGGGAAGATACAAGCAAA pLKO.1 2911 CDS 100% 4.950 2.475 Y WASHC2A n/a
21 TRCN0000344332 GATCGGGAAGATACAAGCAAA pLKO_005 2911 CDS 100% 4.950 2.475 Y WASHC2A n/a
22 TRCN0000158756 GCCAAGTCTATATTTGATGAT pLKO.1 3911 CDS 100% 4.950 2.475 Y WASHC2A n/a
23 TRCN0000344252 GCCAAGTCTATATTTGATGAT pLKO_005 3911 CDS 100% 4.950 2.475 Y WASHC2A n/a
24 TRCN0000136217 GCTCTCTAATACCCAGTTCAT pLKO.1 316 CDS 100% 4.950 2.475 Y WASHC2C n/a
25 TRCN0000137325 GAGGCTGTGAACTATGGCTTA pLKO.1 455 CDS 100% 4.050 2.025 Y WASHC2C n/a
26 TRCN0000134757 GCTACATTGTTGAGTTAGTGA pLKO.1 4110 3UTR 100% 3.000 1.500 Y WASHC2C n/a
27 TRCN0000164732 CAAAGAACCATCCACTCGGAT pLKO.1 2893 CDS 100% 2.640 1.320 Y WASHC2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10086 pDONR223 100% 99.9% 99.9% None 2989C>T n/a
2 ccsbBroad304_10086 pLX_304 0% 99.9% 99.9% V5 2989C>T n/a
Download CSV