Transcript: Human NM_033550.4

Homo sapiens TP53 regulating kinase (TP53RK), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TP53RK (112858)
Length:
3180
CDS:
31..792

Additional Resources:

NCBI RefSeq record:
NM_033550.4
NBCI Gene record:
TP53RK (112858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344810 TATGCTTCCAACTGCTTATAT pLKO_005 346 CDS 100% 15.000 21.000 N TP53RK n/a
2 TRCN0000344811 ACTTTGGGCTGAGTTTCATTT pLKO_005 578 CDS 100% 13.200 10.560 N TP53RK n/a
3 TRCN0000344812 CAGTGACTGTTCGAGATTATA pLKO_005 386 CDS 100% 15.000 10.500 N TP53RK n/a
4 TRCN0000380544 CCCTGGAACAGCTGAACATTG pLKO_005 548 CDS 100% 10.800 7.560 N TP53RK n/a
5 TRCN0000196427 GATCTAAGTAAAGGTGTTAAG pLKO.1 872 3UTR 100% 10.800 7.560 N TP53RK n/a
6 TRCN0000344809 GATCTAAGTAAAGGTGTTAAG pLKO_005 872 3UTR 100% 10.800 7.560 N TP53RK n/a
7 TRCN0000037523 CATAGACTTTGGGCTGAGTTT pLKO.1 573 CDS 100% 4.950 3.465 N TP53RK n/a
8 TRCN0000195075 CAACTGCTTATATATGGAAGA pLKO.1 354 CDS 100% 4.050 2.835 N TP53RK n/a
9 TRCN0000199355 CCAGAGGATAAGGGAGTAGAC pLKO.1 607 CDS 100% 4.050 2.835 N TP53RK n/a
10 TRCN0000037519 GAGATTATATTCAGTCCACTA pLKO.1 398 CDS 100% 4.050 2.835 N TP53RK n/a
11 TRCN0000195649 CTTTCTGAAGAGCTACTCCAC pLKO.1 690 CDS 100% 2.160 1.512 N TP53RK n/a
12 TRCN0000037522 CAGTCCACTATGGAGACTGAA pLKO.1 409 CDS 100% 0.495 0.347 N TP53RK n/a
13 TRCN0000037520 CCCAACACTGAAACTGTGTTT pLKO.1 664 CDS 100% 0.495 0.347 N TP53RK n/a
14 TRCN0000333375 CCCAACACTGAAACTGTGTTT pLKO_005 664 CDS 100% 0.495 0.347 N TP53RK n/a
15 TRCN0000037521 ACCTCCAACATGCTCCTGAAA pLKO.1 523 CDS 100% 4.950 2.970 N TP53RK n/a
16 TRCN0000196805 GAAGACCTCATTCATGGTGAT pLKO.1 496 CDS 100% 4.050 2.430 N TP53RK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04633 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04633 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469981 GTGGACCTAGCCGGTGAGCTGCGC pLX_317 64.8% 100% 100% V5 n/a
4 ccsbBroadEn_15220 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15220 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000480197 ACACGAGGAATACCCCCTTCCCCC pLX_317 44.5% 100% 100% V5 n/a
7 TRCN0000488376 TTCCCGACATTAGTATCGTGTCTG pLX_317 35.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV