Transcript: Human XM_017012474.2

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 12 (PTPN12), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN12 (5782)
Length:
2933
CDS:
147..2144

Additional Resources:

NCBI RefSeq record:
XM_017012474.2
NBCI Gene record:
PTPN12 (5782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338389 CATAGATTATACGTGGAATTT pLKO_005 530 CDS 100% 13.200 18.480 N PTPN12 n/a
2 TRCN0000029879 GCAGTGTAGATTGTTACCTTA pLKO.1 2243 3UTR 100% 4.950 6.930 N Ptpn12 n/a
3 TRCN0000002832 GCTTTGCAGGTTATCAGAGAT pLKO.1 2654 3UTR 100% 4.950 6.930 N PTPN12 n/a
4 TRCN0000271699 TACAGGGCAAGTAGGTATATA pLKO_005 2481 3UTR 100% 15.000 10.500 N Ptpn12 n/a
5 TRCN0000350977 CCATAACGTTTGCACCATTTA pLKO_005 262 CDS 100% 13.200 9.240 N PTPN12 n/a
6 TRCN0000002834 GCCATACCCATACCTGATTTA pLKO.1 1431 CDS 100% 13.200 9.240 N PTPN12 n/a
7 TRCN0000002833 GCCGAGAATTTGAGATGGGAA pLKO.1 199 CDS 100% 2.640 1.848 N PTPN12 n/a
8 TRCN0000002831 CCACCAGAAGAATCCCAGAAT pLKO.1 1329 CDS 100% 4.950 2.970 N PTPN12 n/a
9 TRCN0000350976 CCACCAGAAGAATCCCAGAAT pLKO_005 1329 CDS 100% 4.950 2.970 N PTPN12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06814 pDONR223 100% 85.2% 83.2% None 0_1ins172;36_37ins173;619G>A n/a
2 ccsbBroad304_06814 pLX_304 0% 85.2% 83.2% V5 0_1ins172;36_37ins173;619G>A n/a
3 TRCN0000481594 GAATTGCCAGGGTCGAAGCCGTTA pLX_317 20.1% 85.2% 83.2% V5 0_1ins172;36_37ins173;619G>A n/a
Download CSV