Transcript: Human NM_001017979.3

Homo sapiens RAB28, member RAS oncogene family (RAB28), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RAB28 (9364)
Length:
1690
CDS:
191..856

Additional Resources:

NCBI RefSeq record:
NM_001017979.3
NBCI Gene record:
RAB28 (9364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017979.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048135 GACCTCCTTAACTACGTGTTT pLKO.1 265 CDS 100% 4.950 6.930 N RAB28 n/a
2 TRCN0000048137 GTTGCCTTGGTAGGCAATAAA pLKO.1 560 CDS 100% 1.500 2.100 N RAB28 n/a
3 TRCN0000048136 CTTGAATGTTACCCTTCAAAT pLKO.1 367 CDS 100% 1.320 1.848 N RAB28 n/a
4 TRCN0000382156 ACTTGTATGTGTCAAAGTATA pLKO_005 1246 3UTR 100% 13.200 9.240 N RAB28 n/a
5 TRCN0000048133 GTCCTCTTGGTATATGATATT pLKO.1 455 CDS 100% 13.200 9.240 N RAB28 n/a
6 TRCN0000379915 CAGCAATTTCATTCTCTTATC pLKO_005 1222 3UTR 100% 10.800 7.560 N RAB28 n/a
7 TRCN0000379493 GAATTTAGAAGATTGGTATAC pLKO_005 496 CDS 100% 10.800 7.560 N RAB28 n/a
8 TRCN0000381089 TCCCAACTTGCTTCATCATTG pLKO_005 973 3UTR 100% 10.800 7.560 N RAB28 n/a
9 TRCN0000380425 TGCAGTTCAGTGAGCGCATTT pLKO_005 844 CDS 100% 10.800 7.560 N RAB28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017979.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07402 pDONR223 100% 99.8% 100% None 24C>T n/a
2 ccsbBroad304_07402 pLX_304 0% 99.8% 100% V5 24C>T n/a
3 TRCN0000473153 TGGCCGTGCGGCGTCAATTGTCCA pLX_317 86% 99.6% 22.6% V5 (not translated due to prior stop codon) 24C>T;148delT n/a
4 ccsbBroadEn_11362 pDONR223 100% 42.9% 40.2% None 262_391del;416_663del n/a
5 ccsbBroad304_11362 pLX_304 0% 42.9% 40.2% V5 262_391del;416_663del n/a
6 TRCN0000475182 TAGCCCCCGATCCTGTGGTAATGA pLX_317 100% 42.9% 40.2% V5 262_391del;416_663del n/a
Download CSV