Transcript: Human NM_018263.6

Homo sapiens ASXL transcriptional regulator 2 (ASXL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ASXL2 (55252)
Length:
12849
CDS:
266..4573

Additional Resources:

NCBI RefSeq record:
NM_018263.6
NBCI Gene record:
ASXL2 (55252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018263.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172755 CCGGACTCCATTCTGGTTAAT pLKO.1 1085 CDS 100% 13.200 18.480 N ASXL2 n/a
2 TRCN0000421673 ATACACCCATGAGTCATAAAG pLKO_005 342 CDS 100% 13.200 9.240 N ASXL2 n/a
3 TRCN0000426518 ATACACCCATGAGTCATAAAG pLKO_005 342 CDS 100% 13.200 9.240 N Asxl2 n/a
4 TRCN0000167981 CCAGGTAGAATGGGAGTATAT pLKO.1 488 CDS 100% 13.200 9.240 N ASXL2 n/a
5 TRCN0000438374 GGCACTAAAGCAGGCGCTAAA pLKO_005 757 CDS 100% 10.800 7.560 N ASXL2 n/a
6 TRCN0000167410 GCCAAGAATCTTTAGTTACAT pLKO.1 1815 CDS 100% 5.625 3.938 N ASXL2 n/a
7 TRCN0000172274 CCAACCAGCATCTCTCACTAA pLKO.1 834 CDS 100% 4.950 3.465 N ASXL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018263.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12193 pDONR223 100% 63.9% 63.9% None 1_780del;2387C>T;2507_3277del n/a
2 ccsbBroad304_12193 pLX_304 0% 63.9% 63.9% V5 1_780del;2387C>T;2507_3277del n/a
3 TRCN0000481007 TTCACGTGTTACCCAGATATAACA pLX_317 14.4% 63.9% 63.9% V5 1_780del;2387C>T;2507_3277del n/a
Download CSV