Transcript: Human XM_024453666.1

PREDICTED: Homo sapiens BBX high mobility group box domain containing (BBX), transcript variant X31, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BBX (56987)
Length:
7769
CDS:
302..2089

Additional Resources:

NCBI RefSeq record:
XM_024453666.1
NBCI Gene record:
BBX (56987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016936 CGCAGGCTCCTGTACTTATTT pLKO.1 1982 CDS 100% 15.000 12.000 N BBX n/a
2 TRCN0000436345 AGACATGGCCAAGGAGTATAA pLKO_005 691 CDS 100% 13.200 9.240 N BBX n/a
3 TRCN0000016937 CCACTCTGATGCTTCTACAAA pLKO.1 1069 CDS 100% 5.625 3.938 N BBX n/a
4 TRCN0000016934 GCCTCAGCTTAACTTTGGAAT pLKO.1 877 CDS 100% 4.950 3.465 N BBX n/a
5 TRCN0000016933 CCTGTTACATTTGACCGGAAA pLKO.1 1405 CDS 100% 4.050 2.835 N BBX n/a
6 TRCN0000086432 GCTACCAAGATACTAGCTGAT pLKO.1 629 CDS 100% 4.050 2.835 N Bbx n/a
7 TRCN0000244357 GACATGGCCAAGGAGTATAAA pLKO_005 692 CDS 100% 15.000 10.500 N Bbx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12321 pDONR223 100% 94.7% 94.7% None 1190_1191ins90;1442_1443insGGTACTTTG n/a
2 ccsbBroad304_12321 pLX_304 0% 94.7% 94.7% V5 1190_1191ins90;1442_1443insGGTACTTTG n/a
3 TRCN0000481585 GAACTGATCATAGAGGGAGGCTGA pLX_317 30% 94.7% 94.7% V5 1190_1191ins90;1442_1443insGGTACTTTG n/a
Download CSV