Transcript: Human NM_000391.4

Homo sapiens tripeptidyl peptidase 1 (TPP1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TPP1 (1200)
Length:
3492
CDS:
23..1714

Additional Resources:

NCBI RefSeq record:
NM_000391.4
NBCI Gene record:
TPP1 (1200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000391.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373722 GGATCCTATCCTTGATCAATG pLKO_005 1470 CDS 100% 10.800 15.120 N TPP1 n/a
2 TRCN0000373720 TGGCAGTTCAGTCCCTTATTC pLKO_005 1758 3UTR 100% 13.200 9.240 N TPP1 n/a
3 TRCN0000003572 CCTCGTCTGTTAAGTGTGAAT pLKO.1 3172 3UTR 100% 4.950 3.465 N TPP1 n/a
4 TRCN0000010801 ACCCTAGAGAATGTGGCTGAT pLKO.1 263 CDS 100% 4.050 2.835 N TPP1 n/a
5 TRCN0000003574 GCTATGGAGATGATGAGGACT pLKO.1 993 CDS 100% 2.640 1.848 N TPP1 n/a
6 TRCN0000010800 GCATCAGTAGCCCGTGTGGTT pLKO.1 785 CDS 100% 0.880 0.616 N TPP1 n/a
7 TRCN0000003573 CCCTCTGTGATCCGTAAGCGA pLKO.1 626 CDS 100% 0.250 0.175 N TPP1 n/a
8 TRCN0000373721 ACAGACTCTGTGCACTATTTC pLKO_005 2020 3UTR 100% 13.200 7.920 N TPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000391.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06012 pDONR223 100% 99.9% 99.8% None 1117C>G n/a
2 ccsbBroad304_06012 pLX_304 0% 99.9% 99.8% V5 1117C>G n/a
3 TRCN0000470587 GCCAACCATGCCTCGCACACACCA pLX_317 26.3% 99.9% 99.8% V5 1117C>G n/a
Download CSV