Transcript: Human XM_017027721.2

PREDICTED: Homo sapiens EYA transcriptional coactivator and phosphatase 2 (EYA2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EYA2 (2139)
Length:
2349
CDS:
112..1638

Additional Resources:

NCBI RefSeq record:
XM_017027721.2
NBCI Gene record:
EYA2 (2139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051947 CGAGTCACTTGCTGGTGAATA pLKO.1 759 CDS 100% 13.200 10.560 N EYA2 n/a
2 TRCN0000051944 CCAAGATTTAAGCACATACAA pLKO.1 1047 CDS 100% 5.625 4.500 N EYA2 n/a
3 TRCN0000051943 CGAGAGGATAATGCAGAGATT pLKO.1 1473 CDS 100% 4.950 3.465 N EYA2 n/a
4 TRCN0000051946 GTCTGGATAAACTGAAGTTTA pLKO.1 158 CDS 100% 1.320 0.924 N EYA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10814 pDONR223 100% 89.9% 89.7% None 294_365del;886_887ins90;992G>C n/a
2 ccsbBroad304_10814 pLX_304 0% 89.9% 89.7% V5 294_365del;886_887ins90;992G>C n/a
3 TRCN0000480873 GTAATCCGAGGTCCCTTCATGGCA pLX_317 24.8% 89.9% 89.7% V5 294_365del;886_887ins90;992G>C n/a
4 TRCN0000491450 TTGCACAGCAGGTGCTAGAGGTTA pLX_317 20.9% 89.9% 89.7% V5 (not translated due to prior stop codon) 294_365del;886_887ins90;992G>C n/a
5 TRCN0000491747 CCGATGCCTCCCGTACTACGTGCC pLX_317 22.8% 89.7% 89.7% V5 (many diffs) n/a
Download CSV