Transcript: Human XM_011542113.3

PREDICTED: Homo sapiens coiled-coil domain containing 28B (CCDC28B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC28B (79140)
Length:
2422
CDS:
1108..1833

Additional Resources:

NCBI RefSeq record:
XM_011542113.3
NBCI Gene record:
CCDC28B (79140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172301 CTCTTGCAGTCCTGTCAGATT pLKO.1 1758 CDS 100% 4.950 6.930 N CCDC28B n/a
2 TRCN0000172532 GCTTAGCAATCTGGAAGACCT pLKO.1 1623 CDS 100% 2.640 3.696 N CCDC28B n/a
3 TRCN0000167892 CCTGAACCTGCTCAATGATTT pLKO.1 1392 CDS 100% 13.200 9.240 N CCDC28B n/a
4 TRCN0000167156 CCTTTCAGCATTGAACAATTA pLKO.1 1934 3UTR 100% 13.200 9.240 N CCDC28B n/a
5 TRCN0000167712 GACCTCAGTAATTCTATGTAT pLKO.1 1639 CDS 100% 5.625 3.938 N CCDC28B n/a
6 TRCN0000172580 GCAATCTGGAAGACCTCAGTA pLKO.1 1628 CDS 100% 4.950 3.465 N CCDC28B n/a
7 TRCN0000167920 CAAGTTCAAGAGAGTAGGCAA pLKO.1 1260 CDS 100% 2.640 1.848 N CCDC28B n/a
8 TRCN0000173114 CGTCTATGTGTGTGTGTTCCT pLKO.1 1675 CDS 100% 2.640 1.848 N CCDC28B n/a
9 TRCN0000172581 GTCCTCCTATCCTTTCAGCAT pLKO.1 1924 3UTR 100% 2.640 1.848 N CCDC28B n/a
10 TRCN0000172611 GCAGAAGAAGACAATGGCTGA pLKO.1 1584 CDS 100% 2.160 1.512 N CCDC28B n/a
11 TRCN0000168074 CCCAGGTACAGGAATTTAGAA pLKO.1 1798 CDS 100% 5.625 3.375 N CCDC28B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12548 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12548 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470129 GTTGGCCATCACCTACGCAATTAC pLX_317 44% 100% 100% V5 n/a
4 ccsbBroadEn_15980 pDONR223 0% 79% 76.8% None (many diffs) n/a
5 ccsbBroad304_15980 pLX_304 0% 79% 76.8% V5 (many diffs) n/a
6 TRCN0000480855 CTTAGCTTAGGGGTGTAGGCTCCT pLX_317 59.8% 79% 76.8% V5 (many diffs) n/a
Download CSV