Transcript: Human NM_153710.5

Homo sapiens serine/threonine kinase like domain containing 1 (STKLD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
STKLD1 (169436)
Length:
2826
CDS:
109..2151

Additional Resources:

NCBI RefSeq record:
NM_153710.5
NBCI Gene record:
STKLD1 (169436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153710.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195317 CACTCCTCTTAGGTGACTAAT pLKO.1 2607 3UTR 100% 13.200 18.480 N STKLD1 n/a
2 TRCN0000082449 CTCGGATCGAATAACGATAAA pLKO.1 954 CDS 100% 13.200 18.480 N STKLD1 n/a
3 TRCN0000037436 CCTCGGATCGAATAACGATAA pLKO.1 953 CDS 100% 10.800 15.120 N STKLD1 n/a
4 TRCN0000199357 CCTGCGTCCATCACCGACATG pLKO.1 1054 CDS 100% 0.000 0.000 N STKLD1 n/a
5 TRCN0000037438 CCTGAGTTCCAATGTGCTAAT pLKO.1 633 CDS 100% 10.800 7.560 N STKLD1 n/a
6 TRCN0000037437 GCTGGTGTCCAGTAGTATGAA pLKO.1 1998 CDS 100% 5.625 3.938 N STKLD1 n/a
7 TRCN0000195524 CCATGGAGAAGTACCAGGTTT pLKO.1 179 CDS 100% 4.950 3.465 N STKLD1 n/a
8 TRCN0000037435 CCTGCACCATTTGGACATCAT pLKO.1 549 CDS 100% 4.950 3.465 N STKLD1 n/a
9 TRCN0000082452 GACTCTGAGTGGATGCAGAAT pLKO.1 496 CDS 100% 4.950 3.465 N STKLD1 n/a
10 TRCN0000195169 CCTTAATCATTTCTGGCAAGA pLKO.1 2652 3UTR 100% 4.050 2.835 N STKLD1 n/a
11 TRCN0000197256 GCCACTTCTTGTCATGGTCTA pLKO.1 1398 CDS 100% 4.050 2.835 N STKLD1 n/a
12 TRCN0000082450 GCTAATGACAGACAAAGCCAA pLKO.1 648 CDS 100% 2.640 1.848 N STKLD1 n/a
13 TRCN0000082451 GCATGTGATAAAGCAGGTGGA pLKO.1 267 CDS 100% 2.160 1.512 N STKLD1 n/a
14 TRCN0000082448 CCTTCCAGGAACTGGTTTCTT pLKO.1 2377 3UTR 100% 5.625 3.375 N STKLD1 n/a
15 TRCN0000037434 CCTGAAGACAATGGAGGAGAA pLKO.1 873 CDS 100% 4.050 2.430 N STKLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153710.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491440 CAGCCTCTGCTGTACTATCGTAAG pLX_317 18.8% 99.9% 100% V5 (not translated due to prior stop codon) 1371T>C n/a
Download CSV