Transcript: Human NM_001040451.3

Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RUFY1 (80230)
Length:
2604
CDS:
309..2111

Additional Resources:

NCBI RefSeq record:
NM_001040451.3
NBCI Gene record:
RUFY1 (80230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073074 CGCGAATTACAGCACGAGAAA pLKO.1 1671 CDS 100% 4.950 6.930 N RUFY1 n/a
2 TRCN0000291866 CGCGAATTACAGCACGAGAAA pLKO_005 1671 CDS 100% 4.950 6.930 N RUFY1 n/a
3 TRCN0000073076 CCAAGTTATGTCCAGCATGAA pLKO.1 1460 CDS 100% 4.950 3.960 N RUFY1 n/a
4 TRCN0000291865 CCAAGTTATGTCCAGCATGAA pLKO_005 1460 CDS 100% 4.950 3.960 N RUFY1 n/a
5 TRCN0000241681 AGCTGCAACAGACCGAATTTG pLKO_005 1016 CDS 100% 13.200 9.240 N Rufy1 n/a
6 TRCN0000073073 GCTCTGGTTCAGATACAACTT pLKO.1 2344 3UTR 100% 4.950 3.465 N RUFY1 n/a
7 TRCN0000291793 GCTCTGGTTCAGATACAACTT pLKO_005 2344 3UTR 100% 4.950 3.465 N RUFY1 n/a
8 TRCN0000073075 GCTGAAAGTTAAGAAGAGTTT pLKO.1 461 CDS 100% 4.950 3.465 N RUFY1 n/a
9 TRCN0000291867 GCTGAAAGTTAAGAAGAGTTT pLKO_005 461 CDS 100% 4.950 3.465 N RUFY1 n/a
10 TRCN0000073077 GAGGCTTTAATGATGGAGGAA pLKO.1 705 CDS 100% 2.640 1.584 N RUFY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09020 pDONR223 100% 99.9% 100% None 1218G>A n/a
2 ccsbBroad304_09020 pLX_304 0% 99.9% 100% V5 1218G>A n/a
3 TRCN0000469015 GGAGGAGGTCTCCTAAGCCCCTAG pLX_317 18.1% 99.9% 100% V5 1218G>A n/a
Download CSV