Transcript: Human NM_001281513.2

Homo sapiens hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta (HADHB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
HADHB (3032)
Length:
2080
CDS:
210..1568

Additional Resources:

NCBI RefSeq record:
NM_001281513.2
NBCI Gene record:
HADHB (3032)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028040 CGTTAGCCAAACCCAATATAA pLKO.1 277 CDS 100% 15.000 21.000 N HADHB n/a
2 TRCN0000245333 CGTTAGCCAAACCCAATATAA pLKO_005 277 CDS 100% 15.000 21.000 N HADHB n/a
3 TRCN0000245336 TATAAGCCGAAGGCATATTTG pLKO_005 1134 CDS 100% 13.200 18.480 N HADHB n/a
4 TRCN0000028097 GCCAACAGATTACGGAAAGAA pLKO.1 1467 CDS 100% 5.625 4.500 N HADHB n/a
5 TRCN0000245334 CCCTAAGGAAGTAGTTGATTA pLKO_005 422 CDS 100% 13.200 9.240 N HADHB n/a
6 TRCN0000028070 CCTAAGGAAGTAGTTGATTAT pLKO.1 423 CDS 100% 13.200 9.240 N HADHB n/a
7 TRCN0000028110 CGACTGTCTTTAATCTCTAAA pLKO.1 726 CDS 100% 13.200 9.240 N HADHB n/a
8 TRCN0000245335 CGACTGTCTTTAATCTCTAAA pLKO_005 726 CDS 100% 13.200 9.240 N HADHB n/a
9 TRCN0000028067 CGGCTGGAACAGGATGAATAT pLKO.1 855 CDS 100% 13.200 9.240 N HADHB n/a
10 TRCN0000245337 GTTGTCACTAAAGACTAAATG pLKO_005 1824 3UTR 100% 13.200 9.240 N HADHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10432 pDONR223 100% 94% 93% None (many diffs) n/a
2 ccsbBroad304_10432 pLX_304 0% 94% 93% V5 (many diffs) n/a
3 ccsbBroadEn_10431 pDONR223 100% 93.9% 92.8% None (many diffs) n/a
4 ccsbBroad304_10431 pLX_304 0% 93.9% 92.8% V5 (many diffs) n/a
5 TRCN0000480893 AACCGTCGTCTGCTGCTTGTGTTG pLX_317 33.7% 93.9% 92.8% V5 (many diffs) n/a
Download CSV