Transcript: Human NM_194463.2

Homo sapiens ring finger protein 128 (RNF128), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RNF128 (79589)
Length:
2803
CDS:
214..1500

Additional Resources:

NCBI RefSeq record:
NM_194463.2
NBCI Gene record:
RNF128 (79589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320592 TCTTAACGTGCAACCATATTT pLKO_005 1088 CDS 100% 15.000 12.000 N RNF128 n/a
2 TRCN0000320553 AGAGACTGCTGTTCGAGAAAT pLKO_005 1470 CDS 100% 13.200 9.240 N RNF128 n/a
3 TRCN0000320527 TGCCAATCAGGGCCTAGTTTC pLKO_005 1545 3UTR 100% 10.800 7.560 N RNF128 n/a
4 TRCN0000004798 GCTGTGTGCATTGAATTGTAT pLKO.1 1045 CDS 100% 5.625 3.938 N RNF128 n/a
5 TRCN0000004794 GTGCTTATATTGATCTGGAAT pLKO.1 1916 3UTR 100% 4.950 3.465 N RNF128 n/a
6 TRCN0000004797 GCAGTGGATGTTATTCCTCAT pLKO.1 1408 CDS 100% 4.050 2.835 N RNF128 n/a
7 TRCN0000320524 GCAGTGGATGTTATTCCTCAT pLKO_005 1408 CDS 100% 4.050 2.835 N RNF128 n/a
8 TRCN0000004795 CCGCATCATCTGGATATGCTT pLKO.1 1295 CDS 100% 3.000 2.100 N RNF128 n/a
9 TRCN0000235623 TGCCAATCAGGGCCTAGTTTA pLKO_005 1545 3UTR 100% 13.200 9.240 N Rnf128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04085 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04085 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475445 GAGGATCGCGGGGCACAATCACAC pLX_317 32.2% 100% 100% V5 n/a
Download CSV