Transcript: Human XM_017005916.2

PREDICTED: Homo sapiens DExH-box helicase 30 (DHX30), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX30 (22907)
Length:
3766
CDS:
220..3693

Additional Resources:

NCBI RefSeq record:
XM_017005916.2
NBCI Gene record:
DHX30 (22907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052030 CGCTTACACACGCCATGTATA pLKO.1 1079 CDS 100% 13.200 18.480 N DHX30 n/a
2 TRCN0000303834 AGCGCTTCTCCCGATACTTTG pLKO_005 1898 CDS 100% 10.800 15.120 N DHX30 n/a
3 TRCN0000303777 GGATGAATGCGCACTCGATTT pLKO_005 2043 CDS 100% 10.800 15.120 N DHX30 n/a
4 TRCN0000052028 GCACACAAATGGACCGAAGAA pLKO.1 450 CDS 100% 4.950 6.930 N DHX30 n/a
5 TRCN0000052032 GAGTTGTTTGACGCAGCCAAA pLKO.1 502 CDS 100% 4.050 5.670 N DHX30 n/a
6 TRCN0000303778 ATGGATCAGAAGGCCATATTC pLKO_005 2239 CDS 100% 13.200 9.240 N DHX30 n/a
7 TRCN0000303779 GCTGCACAAGTCGACCATTAA pLKO_005 3276 CDS 100% 13.200 9.240 N DHX30 n/a
8 TRCN0000052029 GCGTCACATATAGGACCAAAT pLKO.1 3242 CDS 100% 10.800 7.560 N DHX30 n/a
9 TRCN0000052031 CCGATGGCTGACGTATTTCAT pLKO.1 3321 CDS 100% 5.625 3.938 N DHX30 n/a
10 TRCN0000299893 CCGATGGCTGACGTATTTCAT pLKO_005 3321 CDS 100% 5.625 3.938 N DHX30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11646 pDONR223 100% 43.2% 43.2% None 1_1968del;3295C>T n/a
2 ccsbBroad304_11646 pLX_304 0% 43.2% 43.2% V5 1_1968del;3295C>T n/a
3 TRCN0000466080 AAATGAGCCCAAAGCTAGAACCAC pLX_317 26.3% 43.2% 43.2% V5 1_1968del;3295C>T n/a
Download CSV