Transcript: Human NM_006439.5

Homo sapiens mab-21 like 2 (MAB21L2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MAB21L2 (10586)
Length:
2543
CDS:
880..1959

Additional Resources:

NCBI RefSeq record:
NM_006439.5
NBCI Gene record:
MAB21L2 (10586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063797 CGCTATGTGGTGCAAATCACT pLKO.1 1372 CDS 100% 3.000 4.200 N MAB21L2 n/a
2 TRCN0000063796 GCTCAATAAGTACTACACTGA pLKO.1 912 CDS 100% 2.640 2.112 N MAB21L2 n/a
3 TRCN0000420394 TTATGTAAGTCACCTGAAATA pLKO_005 2054 3UTR 100% 13.200 9.240 N MAB21L2 n/a
4 TRCN0000063793 GCTCAACAACTACCACATGAA pLKO.1 1683 CDS 100% 4.950 3.465 N MAB21L2 n/a
5 TRCN0000063795 GAAATTCTCACCAATCCCAAA pLKO.1 1921 CDS 100% 4.050 2.835 N MAB21L2 n/a
6 TRCN0000063794 GCGGTGGACAAGTGCAGCTAT pLKO.1 1294 CDS 100% 1.650 1.155 N MAB21L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02478 pDONR223 100% 100% 100% None n/a
2 TRCN0000472802 ACAAATTCCAATAGAATATCATGG pLX_317 23.3% 100% 100% V5 n/a
3 ccsbBroadEn_00958 pDONR223 100% 79.6% 94.1% None (many diffs) n/a
4 ccsbBroad304_00958 pLX_304 0% 79.6% 94.1% V5 (many diffs) n/a
5 TRCN0000474799 TGCACTATCACAGGATTGACTAAC pLX_317 37.1% 79.6% 94.1% V5 (many diffs) n/a
Download CSV