Transcript: Human XR_931950.3

PREDICTED: Homo sapiens phosphatidylinositol glycan anchor biosynthesis class B (PIGB), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIGB (9488)
Length:
1979
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931950.3
NBCI Gene record:
PIGB (9488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154880 CTGTAGCAGATGTGAGACTTT pLKO.1 767 3UTR 100% 4.950 3.960 N PIGB n/a
2 TRCN0000154387 CCATGGAAACTGTTCTCACTA pLKO.1 896 3UTR 100% 4.950 3.465 N PIGB n/a
3 TRCN0000278520 CCATGGAAACTGTTCTCACTA pLKO_005 896 3UTR 100% 4.950 3.465 N PIGB n/a
4 TRCN0000156578 GCTGCTATCTAGCACCAAAGA pLKO.1 1301 3UTR 100% 4.950 3.465 N PIGB n/a
5 TRCN0000297200 GCTGCTATCTAGCACCAAAGA pLKO_005 1301 3UTR 100% 4.950 3.465 N PIGB n/a
6 TRCN0000155296 GCTGGGTGGAAATATTCAGAT pLKO.1 1787 3UTR 100% 4.950 3.465 N PIGB n/a
7 TRCN0000157804 CGGCAAGATAAAGCTGCGAAA pLKO.1 399 3UTR 100% 4.050 2.835 N PIGB n/a
8 TRCN0000278521 CGGCAAGATAAAGCTGCGAAA pLKO_005 399 3UTR 100% 4.050 2.835 N PIGB n/a
9 TRCN0000154702 GCGAAAGAGAAAGTCTACCTT pLKO.1 414 3UTR 100% 3.000 2.100 N PIGB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07427 pDONR223 100% 65.8% None (many diffs) n/a
2 ccsbBroad304_07427 pLX_304 0% 65.8% V5 (many diffs) n/a
3 TRCN0000477998 CCAACGTGTATCGCGAAAGGCTGA pLX_317 24% 65.8% V5 (many diffs) n/a
Download CSV