Transcript: Mouse XM_006505488.3

PREDICTED: Mus musculus dynactin 1 (Dctn1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dctn1 (13191)
Length:
4337
CDS:
237..4031

Additional Resources:

NCBI RefSeq record:
XM_006505488.3
NBCI Gene record:
Dctn1 (13191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419551 CCACGAGCGCTCCTTAGATTT pLKO_005 2267 CDS 100% 13.200 18.480 N Dctn1 n/a
2 TRCN0000431499 CCATGCAAGAAGGCGAGTATG pLKO_005 2902 CDS 100% 10.800 15.120 N Dctn1 n/a
3 TRCN0000429307 GTCAATCGGGAGCTGACAAAC pLKO_005 1773 CDS 100% 10.800 15.120 N Dctn1 n/a
4 TRCN0000431369 CAGACGAGCGAATCGAGAAAG pLKO_005 3145 CDS 100% 10.800 8.640 N Dctn1 n/a
5 TRCN0000437676 AGTGCAGTGTGGACGTGTATA pLKO_005 2212 CDS 100% 13.200 9.240 N Dctn1 n/a
6 TRCN0000100382 CCAGTCCCAGATCCAAGTATT pLKO.1 455 CDS 100% 13.200 9.240 N Dctn1 n/a
7 TRCN0000100381 CCGTCAGTTCTGCAAGAAGAT pLKO.1 2567 CDS 100% 4.950 3.465 N Dctn1 n/a
8 TRCN0000100383 GCAACAGATATTGCCCTTCTT pLKO.1 2514 CDS 100% 4.950 3.465 N Dctn1 n/a
9 TRCN0000100384 CGCATCAAGCTACCAGCTCAA pLKO.1 1247 CDS 100% 4.050 2.835 N Dctn1 n/a
10 TRCN0000100380 CTTCCCTGCCTTCCCTGTGGT pLKO.1 4038 3UTR 100% 0.000 0.000 N Dctn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06086 pDONR223 100% 80.8% 87.2% None (many diffs) n/a
2 ccsbBroad304_06086 pLX_304 0% 80.8% 87.2% V5 (many diffs) n/a
3 TRCN0000491671 CGGCAGCGCTTACGCACGCAAGAA pLX_317 8% 80.8% 87.2% V5 (many diffs) n/a
4 ccsbBroadEn_10771 pDONR223 100% 14% 14.7% None (many diffs) n/a
5 ccsbBroad304_10771 pLX_304 0% 14% 14.7% V5 (many diffs) n/a
6 TRCN0000471305 ATTAACCCGCCAATCATTCTCCCT pLX_317 76.3% 14% 14.7% V5 (many diffs) n/a
Download CSV