Transcript: Mouse NM_009897.3

Mus musculus creatine kinase, mitochondrial 1, ubiquitous (Ckmt1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Mus musculus (mouse)
Gene:
Ckmt1 (12716)
Length:
1620
CDS:
241..1497

Additional Resources:

NCBI RefSeq record:
NM_009897.3
NBCI Gene record:
Ckmt1 (12716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024928 GTGATCCAAGAGCGGCATAAT pLKO.1 616 CDS 100% 13.200 18.480 N Ckmt1 n/a
2 TRCN0000024926 CCGAAAGCACAACAACTGCAT pLKO.1 411 CDS 100% 2.640 3.696 N Ckmt1 n/a
3 TRCN0000181051 CCGAAAGCACAACAACTGCAT pLKO.1 411 CDS 100% 2.640 3.696 N CKMT1A n/a
4 TRCN0000361096 TGATCCAAGAGCGGCATAATG pLKO_005 617 CDS 100% 13.200 10.560 N Ckmt1 n/a
5 TRCN0000361094 ACCTGGCTGGACGGTACTATA pLKO_005 845 CDS 100% 13.200 9.240 N Ckmt1 n/a
6 TRCN0000024925 GCCACTGCTGAGCAAAGATAA pLKO.1 1239 CDS 100% 13.200 9.240 N Ckmt1 n/a
7 TRCN0000361095 GCCGAACAGCAGCAGCTTATT pLKO_005 886 CDS 100% 13.200 9.240 N Ckmt1 n/a
8 TRCN0000243703 TGAGGAGACCTATGAGGTATT pLKO_005 576 CDS 100% 10.800 7.560 N CKMT1A n/a
9 TRCN0000024927 CGGCAACATGAAGAGAGTGTT pLKO.1 1071 CDS 100% 4.950 3.465 N Ckmt1 n/a
10 TRCN0000024924 GCAGCGTCTTTGACATCTCTA pLKO.1 1334 CDS 100% 4.950 3.465 N Ckmt1 n/a
11 TRCN0000195676 CGAAAGCACAACAACTGCATG pLKO.1 412 CDS 100% 4.050 2.835 N CKMT1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05701 pDONR223 100% 92.2% 96.6% None (many diffs) n/a
2 ccsbBroad304_05701 pLX_304 0% 92.2% 96.6% V5 (many diffs) n/a
3 TRCN0000471987 CACAGATGCACTAACCCGGCGGCA pLX_317 30.9% 92.2% 96.6% V5 (many diffs) n/a
4 ccsbBroadEn_15331 pDONR223 0% 92.2% 96.6% None (many diffs) n/a
5 ccsbBroad304_15331 pLX_304 0% 92.2% 96.6% V5 (many diffs) n/a
6 TRCN0000475004 CCAGTAAAACGGTGTAACTTCAAA pLX_317 37.8% 92.2% 96.6% V5 (many diffs) n/a
7 TRCN0000488041 AATCCCTCTTGATCACATCACAAC pLX_317 26.3% 92.2% 96.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_00314 pDONR223 100% 92.1% 96.6% None (many diffs) n/a
9 ccsbBroad304_00314 pLX_304 0% 92.1% 96.6% V5 (many diffs) n/a
10 TRCN0000473448 TAGCCCCGACCAGACGGTTAACAC pLX_317 38.2% 92.1% 96.6% V5 (many diffs) n/a
Download CSV