Transcript: Mouse XM_006530533.4

PREDICTED: Mus musculus phosphorylase kinase beta (Phkb), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Phkb (102093)
Length:
8323
CDS:
257..3514

Additional Resources:

NCBI RefSeq record:
XM_006530533.4
NBCI Gene record:
Phkb (102093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530533.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025080 CCAGCCAAAGTATAGACAGAT pLKO.1 3205 CDS 100% 4.950 6.930 N Phkb n/a
2 TRCN0000345017 CCAGCCAAAGTATAGACAGAT pLKO_005 3205 CDS 100% 4.950 6.930 N Phkb n/a
3 TRCN0000025081 CGCACACCTAATGGTATCGTT pLKO.1 3083 CDS 100% 3.000 4.200 N Phkb n/a
4 TRCN0000345016 CGCACACCTAATGGTATCGTT pLKO_005 3083 CDS 100% 3.000 4.200 N Phkb n/a
5 TRCN0000025082 GCACTACAGTTCATTAAGCAA pLKO.1 2033 CDS 100% 3.000 4.200 N Phkb n/a
6 TRCN0000345015 GCACTACAGTTCATTAAGCAA pLKO_005 2033 CDS 100% 3.000 4.200 N Phkb n/a
7 TRCN0000025079 GCTCACTGTTACCCAGAGAAT pLKO.1 1071 CDS 100% 4.950 3.465 N Phkb n/a
8 TRCN0000345014 GCTCACTGTTACCCAGAGAAT pLKO_005 1071 CDS 100% 4.950 3.465 N Phkb n/a
9 TRCN0000006197 GCTCAGTTTATGAACCTCTTA pLKO.1 309 CDS 100% 4.950 3.465 N PHKB n/a
10 TRCN0000025083 GCTGATAAGGTCCAACAGTTT pLKO.1 629 CDS 100% 4.950 3.465 N Phkb n/a
11 TRCN0000345013 GCTGATAAGGTCCAACAGTTT pLKO_005 629 CDS 100% 4.950 3.465 N Phkb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530533.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14754 pDONR223 0% 88.3% 93% None (many diffs) n/a
2 ccsbBroad304_14754 pLX_304 0% 88.3% 93% V5 (many diffs) n/a
3 TRCN0000474290 CTTATGACAAAAGCCCCCCGACTC pLX_317 13.7% 88.3% 93% V5 (many diffs) n/a
4 ccsbBroadEn_14753 pDONR223 74.1% 88.2% 92.8% None (many diffs) n/a
5 ccsbBroad304_14753 pLX_304 0% 88.2% 92.8% V5 (many diffs) n/a
6 TRCN0000478777 TGTCCCTAGTTAATCGCTATTCCA pLX_317 9.7% 88.2% 92.8% V5 (many diffs) n/a
Download CSV