Transcript: Mouse XM_001474178.5

PREDICTED: Mus musculus predicted gene 2573 (Gm2573), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm2573 (100040052)
Length:
837
CDS:
189..509

Additional Resources:

NCBI RefSeq record:
XM_001474178.5
NBCI Gene record:
Gm2573 (100040052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_001474178.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124084 CCCTGCTTCTGCTTTGACAAA pLKO.1 667 3UTR 100% 4.950 2.475 Y Wdr83os n/a
2 TRCN0000326754 CCCTGCTTCTGCTTTGACAAA pLKO_005 667 3UTR 100% 4.950 2.475 Y Wdr83os n/a
3 TRCN0000124086 CCGGACTACATGAATCTTCTT pLKO.1 288 CDS 100% 4.950 2.475 Y Wdr83os n/a
4 TRCN0000326679 CCGGACTACATGAATCTTCTT pLKO_005 288 CDS 100% 4.950 2.475 Y Wdr83os n/a
5 TRCN0000124088 GCAGATGATGAGTAGCTTCAT pLKO.1 422 CDS 100% 4.950 2.475 Y Wdr83os n/a
6 TRCN0000326681 GCAGATGATGAGTAGCTTCAT pLKO_005 422 CDS 100% 4.950 2.475 Y Wdr83os n/a
7 TRCN0000124087 CTACTGCTCCTTTATCAGCTT pLKO.1 371 CDS 100% 2.640 1.320 Y Wdr83os n/a
8 TRCN0000326680 CTACTGCTCCTTTATCAGCTT pLKO_005 371 CDS 100% 2.640 1.320 Y Wdr83os n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_001474178.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03299 pDONR223 100% 90.5% 98.1% None (many diffs) n/a
2 ccsbBroad304_03299 pLX_304 0% 90.5% 98.1% V5 (many diffs) n/a
3 TRCN0000469475 GGTGCAGACTGCTTGTCACCTAAT pLX_317 100% 90.5% 98.1% V5 (many diffs) n/a
Download CSV