Transcript: Mouse XM_003688749.3

PREDICTED: Mus musculus 40S ribosomal protein S16 (LOC100862433), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC100862433 (100862433)
Length:
566
CDS:
16..513

Additional Resources:

NCBI RefSeq record:
XM_003688749.3
NBCI Gene record:
LOC100862433 (100862433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_003688749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255554 GTGGACATGTGGCCCAAATTT pLKO_005 296 CDS 100% 15.000 7.500 Y Rps16-ps2 n/a
2 TRCN0000255550 CAAAGGCCCTGGTAGCTTATT pLKO_005 338 CDS 100% 13.200 6.600 Y Rps16-ps2 n/a
3 TRCN0000255551 CCTCCAAGAAGGAGATCAAAG pLKO_005 380 CDS 100% 10.800 5.400 Y Rps16-ps2 n/a
4 TRCN0000255552 CTTCTGGGCAAGGAGCGATTT pLKO_005 241 CDS 100% 10.800 5.400 Y Rps16-ps2 n/a
5 TRCN0000255553 GCACGCTGCAGTACAAGTTAC pLKO_005 206 CDS 100% 10.800 5.400 Y Rps16-ps2 n/a
6 TRCN0000104185 GCCTCCAAGAAGGAGATCAAA pLKO.1 379 CDS 100% 5.625 2.813 Y Rps16 n/a
7 TRCN0000104189 TCCAAGAAGGAGATCAAAGAT pLKO.1 382 CDS 100% 5.625 2.813 Y Rps16 n/a
8 TRCN0000104188 TGTGGATATTCGGGTCCGTGT pLKO.1 267 CDS 100% 2.160 1.080 Y Rps16 n/a
9 TRCN0000104186 GCAGGTCTTCGGACGCAAGAA pLKO.1 102 CDS 100% 1.650 0.825 Y Rps16 n/a
10 TRCN0000104187 CCCTGGTAGCTTATTACCAAA pLKO.1 344 CDS 100% 0.495 0.248 Y Rps16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_003688749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15581 pDONR223 0% 78.9% 86.6% None (many diffs) n/a
2 ccsbBroad304_15581 pLX_304 0% 78.9% 86.6% V5 (many diffs) n/a
3 ccsbBroadEn_01455 pDONR223 100% 78.7% 86.6% None (many diffs) n/a
4 ccsbBroad304_01455 pLX_304 0% 78.7% 86.6% V5 (many diffs) n/a
5 TRCN0000472435 GGACCGTGTACATGATTACCGCAA pLX_317 90.6% 78.7% 86.6% V5 (many diffs) n/a
6 ccsbBroadEn_11110 pDONR223 100% 54.2% 49.7% None (many diffs) n/a
7 ccsbBroad304_11110 pLX_304 0% 54.2% 49.7% V5 (many diffs) n/a
8 TRCN0000470408 GGGGCCCAAATCAATACGGCCTAT pLX_317 90.9% 54.2% 49.7% V5 (many diffs) n/a
Download CSV