Transcript: Human XM_005245000.4

PREDICTED: Homo sapiens pogo transposable element derived with ZNF domain (POGZ), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POGZ (23126)
Length:
6552
CDS:
875..5107

Additional Resources:

NCBI RefSeq record:
XM_005245000.4
NBCI Gene record:
POGZ (23126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229993 GTGGCCTCACAACCAATATTT pLKO_005 1301 CDS 100% 15.000 21.000 N POGZ n/a
2 TRCN0000005709 CCACGATGTAATGCTCAATTT pLKO.1 2006 CDS 100% 13.200 18.480 N POGZ n/a
3 TRCN0000218065 AGACTCTTGTCACACTAATTG pLKO_005 1125 CDS 100% 13.200 10.560 N POGZ n/a
4 TRCN0000005711 GCCACTATTTCTCCAGCATAT pLKO.1 2590 CDS 100% 10.800 7.560 N POGZ n/a
5 TRCN0000421458 GCTATTGATGAGATCTCTTTG pLKO_005 4244 CDS 100% 10.800 7.560 N Pogz n/a
6 TRCN0000005708 CCCAAGTATTTGGCTTTGTTT pLKO.1 3272 CDS 100% 5.625 3.938 N POGZ n/a
7 TRCN0000005710 CCCTAATCATTTCCCTACTTA pLKO.1 3163 CDS 100% 5.625 3.938 N POGZ n/a
8 TRCN0000218316 ATGGTTACTCAACCAGTATTG pLKO_005 1232 CDS 100% 1.080 0.756 N POGZ n/a
9 TRCN0000098928 CGCACTCACTTGTCAGAAGAA pLKO.1 4568 CDS 100% 4.950 3.465 N Pogz n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 30 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 30 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491523 TCCATTTGCTCACTTCTCCAGGCC pLX_317 7.7% 96.2% 96.2% V5 (not translated due to prior stop codon) 124_282del;4104T>G n/a
2 ccsbBroadEn_11681 pDONR223 100% 25.5% 25.5% None 1078_1079insGTACAA;1080G>A;1084_4230del n/a
3 ccsbBroad304_11681 pLX_304 0% 25.5% 25.5% V5 1078_1079insGTACAA;1080G>A;1084_4230del n/a
4 TRCN0000467762 TAGATAGTTCGACTCTATTATGTG pLX_317 41.5% 25.5% 25.5% V5 1078_1079insGTACAA;1080G>A;1084_4230del n/a
Download CSV