Transcript: Human XM_005245218.2

PREDICTED: Homo sapiens natriuretic peptide receptor 1 (NPR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPR1 (4881)
Length:
4146
CDS:
461..3568

Additional Resources:

NCBI RefSeq record:
XM_005245218.2
NBCI Gene record:
NPR1 (4881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199127 CGCCTGACGTTGCGCAAATTT pLKO.1 2774 CDS 100% 15.000 21.000 N NPR1 n/a
2 TRCN0000379958 GCCTGACGTTGCGCAAATTTA pLKO_005 2775 CDS 100% 15.000 21.000 N NPR1 n/a
3 TRCN0000007329 GCTTTCAAGGTGTGACAGGAT pLKO.1 1623 CDS 100% 2.640 3.696 N NPR1 n/a
4 TRCN0000349578 GCTTTCAAGGTGTGACAGGAT pLKO_005 1623 CDS 100% 2.640 3.696 N NPR1 n/a
5 TRCN0000007325 GCCAAAGGATGGAAGTAATTT pLKO.1 3661 3UTR 100% 15.000 10.500 N NPR1 n/a
6 TRCN0000349647 GCCAAAGGATGGAAGTAATTT pLKO_005 3661 3UTR 100% 15.000 10.500 N NPR1 n/a
7 TRCN0000007326 GCCTCAAGAATGGAGTCTAAT pLKO.1 3386 CDS 100% 13.200 9.240 N NPR1 n/a
8 TRCN0000349646 GCCTCAAGAATGGAGTCTAAT pLKO_005 3386 CDS 100% 13.200 9.240 N NPR1 n/a
9 TRCN0000007328 GCTGTCATAGACAACTTTGAT pLKO.1 3110 CDS 100% 5.625 3.938 N NPR1 n/a
10 TRCN0000318769 GCTGTCATAGACAACTTTGAT pLKO_005 3110 CDS 100% 5.625 3.938 N NPR1 n/a
11 TRCN0000007327 CCCAGATAATCCCGAGTACTT pLKO.1 1408 CDS 100% 4.950 3.465 N NPR1 n/a
12 TRCN0000199228 CCCTCAGCCTTGCTACCCTGT pLKO.1 3892 3UTR 100% 0.000 0.000 N NPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488907 AGGCGTGCCGTTCCACTCACTATC pLX_317 11.4% 97.5% 97.5% V5 1680_1681ins78;2601A>G n/a
2 TRCN0000487819 TTAACACTCCCCGGCGCAGTGGAG pLX_317 7.8% 97.5% 97.5% V5 (not translated due to prior stop codon) 1680_1681ins78;2601A>G n/a
3 ccsbBroadEn_13913 pDONR223 100% 97.4% 97.1% None (many diffs) n/a
4 ccsbBroad304_13913 pLX_304 0% 97.4% 97.1% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV