Transcript: Human XM_005245357.1

PREDICTED: Homo sapiens VANGL planar cell polarity protein 2 (VANGL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VANGL2 (57216)
Length:
5155
CDS:
294..1859

Additional Resources:

NCBI RefSeq record:
XM_005245357.1
NBCI Gene record:
VANGL2 (57216)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418440 GTCACAATGAGTACTACTATG pLKO_005 1303 CDS 100% 10.800 15.120 N VANGL2 n/a
2 TRCN0000147138 CAAGTCACACAAGTTTGTCAT pLKO.1 1811 CDS 100% 4.950 3.960 N VANGL2 n/a
3 TRCN0000447024 AGGAGGCCTTCACTCACATTA pLKO_005 1384 CDS 100% 13.200 9.240 N VANGL2 n/a
4 TRCN0000417141 TTCAAACTCTCCGAGGAATTT pLKO_005 1782 CDS 100% 13.200 9.240 N VANGL2 n/a
5 TRCN0000179392 GATCCCAAGTCACACAAGTTT pLKO.1 1806 CDS 100% 5.625 3.938 N VANGL2 n/a
6 TRCN0000180622 GTGTGGATCCTGGAGAAGTAT pLKO.1 1110 CDS 100% 5.625 3.938 N VANGL2 n/a
7 TRCN0000180101 CTTCATCTCTGTCGCCTTCAA pLKO.1 737 CDS 100% 4.950 3.465 N VANGL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08718 pDONR223 100% 99.9% 100% None 1137A>G n/a
2 ccsbBroad304_08718 pLX_304 0% 99.9% 100% V5 1137A>G n/a
3 TRCN0000471123 AGATCCATGTCGATGCTCTGGCTT pLX_317 22.5% 99.9% 100% V5 1137A>G n/a
Download CSV