Transcript: Human XM_005245850.3

PREDICTED: Homo sapiens AT-hook DNA binding motif containing 1 (AHDC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHDC1 (27245)
Length:
6714
CDS:
1192..6003

Additional Resources:

NCBI RefSeq record:
XM_005245850.3
NBCI Gene record:
AHDC1 (27245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240749 CCCGGTGAGATGCCCATTATT pLKO_005 2797 CDS 100% 15.000 21.000 N AHDC1 n/a
2 TRCN0000240747 TGGTCCCGTGGTGTGCAAATT pLKO_005 6497 3UTR 100% 13.200 18.480 N AHDC1 n/a
3 TRCN0000241817 TGGTCCCGTGGTGTGCAAATT pLKO_005 6497 3UTR 100% 13.200 18.480 N Ahdc1 n/a
4 TRCN0000240746 CCTTTAGTCAGCTCTACAATC pLKO_005 4559 CDS 100% 10.800 8.640 N AHDC1 n/a
5 TRCN0000168299 GCCTTTAGTCAGCTCTACAAT pLKO.1 4558 CDS 100% 5.625 4.500 N AHDC1 n/a
6 TRCN0000240750 ACCTCGGCCTGGACTACTATA pLKO_005 5123 CDS 100% 13.200 9.240 N AHDC1 n/a
7 TRCN0000240748 CCTCCGATCTCTTGGACTTTG pLKO_005 3737 CDS 100% 10.800 7.560 N AHDC1 n/a
8 TRCN0000172272 CGAGCTTGATGGCAAGCATTT pLKO.1 5310 CDS 100% 1.080 0.756 N AHDC1 n/a
9 TRCN0000173091 CTACAGGTACCCAGGCTTTAT pLKO.1 5880 CDS 100% 0.000 0.000 N AHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11858 pDONR223 100% 24.8% 24.8% None 1_3612del;4806C>T n/a
2 ccsbBroad304_11858 pLX_304 0% 24.8% 24.8% V5 1_3612del;4806C>T n/a
3 TRCN0000480729 ACTTAAGTTCTTTCTTATGTAATC pLX_317 26.4% 24.8% 24.8% V5 1_3612del;4806C>T n/a
Download CSV