Transcript: Human XM_005246232.3

PREDICTED: Homo sapiens calcitonin receptor like receptor (CALCRL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CALCRL (10203)
Length:
5084
CDS:
601..2019

Additional Resources:

NCBI RefSeq record:
XM_005246232.3
NBCI Gene record:
CALCRL (10203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356733 CCATTGCTAGAAGCTTATATT pLKO_005 1445 CDS 100% 15.000 21.000 N CALCRL n/a
2 TRCN0000008170 CGTTCTCATCACCAAGTTAAA pLKO.1 1575 CDS 100% 13.200 18.480 N CALCRL n/a
3 TRCN0000356736 TTACCTGATGGGCTGTAATTA pLKO_005 1293 CDS 100% 15.000 10.500 N CALCRL n/a
4 TRCN0000356798 CTTATCTCGCTTGGCATATTC pLKO_005 1102 CDS 100% 13.200 9.240 N CALCRL n/a
5 TRCN0000356734 GGGCATGATTCTACCCTTATT pLKO_005 2391 3UTR 100% 13.200 9.240 N CALCRL n/a
6 TRCN0000008168 GCTGCTTTACTGGTGAATCTT pLKO.1 1531 CDS 100% 5.625 3.938 N CALCRL n/a
7 TRCN0000008169 GCTCAATATGAATGTTACCAA pLKO.1 763 CDS 100% 3.000 2.100 N CALCRL n/a
8 TRCN0000008167 CCCTGATTACTTTCAGGACTT pLKO.1 897 CDS 100% 0.405 0.284 N CALCRL n/a
9 TRCN0000008166 CCTTCCATTTCTACTGTATAA pLKO.1 2832 3UTR 100% 13.200 7.920 N CALCRL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488244 GTTTCTTGTTAGTCGACGTTCTAC pLX_317 19.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV