Transcript: Human XM_005246708.4

PREDICTED: Homo sapiens neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 (NYAP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NYAP2 (57624)
Length:
8792
CDS:
1047..3008

Additional Resources:

NCBI RefSeq record:
XM_005246708.4
NBCI Gene record:
NYAP2 (57624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246708.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264252 AGGACTGAAGCGTCAGCTAAA pLKO_005 1560 CDS 100% 10.800 15.120 N NYAP2 n/a
2 TRCN0000264254 CTTAGCTCTTATCCTATTATA pLKO_005 3458 3UTR 100% 15.000 10.500 N NYAP2 n/a
3 TRCN0000268454 TGAAACTAACCTAGCCTATTT pLKO_005 1199 CDS 100% 13.200 9.240 N NYAP2 n/a
4 TRCN0000264253 ACTTGGGCCAAGACGCCAAAT pLKO_005 1879 CDS 100% 10.800 7.560 N NYAP2 n/a
5 TRCN0000268408 ATCGTTAGCCAATCGTGATTG pLKO_005 2987 CDS 100% 10.800 7.560 N NYAP2 n/a
6 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 5255 3UTR 100% 4.050 2.025 Y LOC441087 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7330 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5200 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246708.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12377 pDONR223 100% 22.1% 13.7% None (many diffs) n/a
2 TRCN0000466404 CGGCTCATCTACCAGAGCAAAGTC pLX_317 77.7% 22.1% 13.7% V5 (many diffs) n/a
Download CSV