Transcript: Human XM_005247534.2

PREDICTED: Homo sapiens phospholipase D1 (PLD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLD1 (5337)
Length:
5981
CDS:
197..3307

Additional Resources:

NCBI RefSeq record:
XM_005247534.2
NBCI Gene record:
PLD1 (5337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422972 ACCGGGTATATGTCGTGATAC pLKO_005 2526 CDS 100% 10.800 15.120 N PLD1 n/a
2 TRCN0000076820 CCCAATGATGAAGTACACAAT pLKO.1 3098 CDS 100% 4.950 6.930 N Pld1 n/a
3 TRCN0000352251 CCCAATGATGAAGTACACAAT pLKO_005 3098 CDS 100% 4.950 6.930 N Pld1 n/a
4 TRCN0000010571 GCATTCTCGTATCCAACCCAA pLKO.1 3402 3UTR 100% 2.640 3.696 N PLD1 n/a
5 TRCN0000001011 GCGTCTACATCCCAACATAAA pLKO.1 1513 CDS 100% 13.200 10.560 N PLD1 n/a
6 TRCN0000422006 AGGATTTAAGGAGCCTAATAT pLKO_005 391 CDS 100% 15.000 10.500 N PLD1 n/a
7 TRCN0000420267 ACCGGGTCCATCCGTAGTTTA pLKO_005 1952 CDS 100% 13.200 9.240 N PLD1 n/a
8 TRCN0000010572 CCACTAGAAGACACACGTTTA pLKO.1 621 CDS 100% 10.800 7.560 N PLD1 n/a
9 TRCN0000001010 GCAATGGAAGAGGCAAATGAA pLKO.1 1298 CDS 100% 5.625 3.938 N PLD1 n/a
10 TRCN0000001009 GCAAGTTAAGAGGAAATTCAA pLKO.1 538 CDS 100% 5.625 3.375 N PLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01216 pDONR223 100% 96.4% 96.3% None 1753_1754ins114 n/a
2 ccsbBroad304_01216 pLX_304 0% 96.4% 96.3% V5 1753_1754ins114 n/a
3 TRCN0000470850 GCCGCTAACCCCAAAACTTCAATT pLX_317 12.6% 96.4% 96.3% V5 1753_1754ins114 n/a
Download CSV