Transcript: Human XM_005247546.2

PREDICTED: Homo sapiens GRAM domain containing 1C (GRAMD1C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD1C (54762)
Length:
3677
CDS:
89..1981

Additional Resources:

NCBI RefSeq record:
XM_005247546.2
NBCI Gene record:
GRAMD1C (54762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243940 AGATCAGGCCCATCGTTTAAA pLKO_005 1843 CDS 100% 15.000 21.000 N GRAMD1C n/a
2 TRCN0000243937 AGAACGATGACCTACACTATA pLKO_005 1130 CDS 100% 13.200 18.480 N GRAMD1C n/a
3 TRCN0000243941 GAGAATAATGTGGTAGTTAAA pLKO_005 194 CDS 100% 13.200 18.480 N GRAMD1C n/a
4 TRCN0000182959 CGTGAACAGATACTGTATCAT pLKO.1 1294 CDS 100% 5.625 7.875 N GRAMD1C n/a
5 TRCN0000243938 AGCAAGAATGAGTGGATTATA pLKO_005 3440 3UTR 100% 15.000 10.500 N GRAMD1C n/a
6 TRCN0000243939 CTTTACCAGTTCACGCTTTAT pLKO_005 1030 CDS 100% 13.200 9.240 N GRAMD1C n/a
7 TRCN0000179617 GCTGAAGAGCTCACTCATTAT pLKO.1 1900 CDS 100% 13.200 9.240 N GRAMD1C n/a
8 TRCN0000183020 CCATGATTACTTCTATACCGT pLKO.1 1276 CDS 100% 0.750 0.525 N GRAMD1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10460 pDONR223 100% 95% 94.8% None 363_364ins96;1835T>C;1886delA n/a
2 ccsbBroad304_10460 pLX_304 0% 95% 94.8% V5 (not translated due to frame shift) 363_364ins96;1835T>C;1886delA n/a
3 TRCN0000474735 ACCGCAGTCGGGCCAGTCTGCTCG pLX_317 19.9% 95% 94.8% V5 (not translated due to frame shift) 363_364ins96;1835T>C;1886delA n/a
4 ccsbBroadEn_14169 pDONR223 100% 50.9% 50.9% None 1_927del n/a
5 ccsbBroad304_14169 pLX_304 0% 50.9% 50.9% V5 1_927del n/a
6 TRCN0000471702 GGCAACGCACCATAGGTCCTAAAC pLX_317 37.3% 50.9% 50.9% V5 1_927del n/a
Download CSV