Transcript: Human XM_005247692.2

PREDICTED: Homo sapiens G protein subunit beta 4 (GNB4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNB4 (59345)
Length:
2489
CDS:
202..1224

Additional Resources:

NCBI RefSeq record:
XM_005247692.2
NBCI Gene record:
GNB4 (59345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036918 GCTGGTTACGATGACTTTAAT pLKO.1 1060 CDS 100% 15.000 21.000 N GNB4 n/a
2 TRCN0000420318 TGGGATAGCTATACAACAAAT pLKO_005 445 CDS 100% 13.200 18.480 N GNB4 n/a
3 TRCN0000036917 GTCGAATACAAATGCGAACAA pLKO.1 323 CDS 100% 4.950 6.930 N GNB4 n/a
4 TRCN0000036914 GCCTCTTCCAAATTATGGGAT pLKO.1 817 CDS 100% 2.640 2.112 N GNB4 n/a
5 TRCN0000036916 CGTGCAGATCAAGAGTTATTA pLKO.1 967 CDS 100% 15.000 10.500 N GNB4 n/a
6 TRCN0000414869 ATGCTCCCTCTGGTAATTATG pLKO_005 515 CDS 100% 13.200 9.240 N GNB4 n/a
7 TRCN0000432517 TGTGAGCTGCTTAGGTGTAAC pLKO_005 1143 CDS 100% 10.800 7.560 N GNB4 n/a
8 TRCN0000036915 GCTCGGAAAGCATGTAATGAT pLKO.1 262 CDS 100% 5.625 3.938 N GNB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08785 pDONR223 100% 99.8% 99.7% None 11T>C;117T>C n/a
2 ccsbBroad304_08785 pLX_304 0% 99.8% 99.7% V5 11T>C;117T>C n/a
3 TRCN0000470309 TTAATCACTAATCACTGTATTAGT pLX_317 39.7% 99.8% 99.7% V5 11T>C;117T>C n/a
Download CSV