Transcript: Human XM_005247694.4

PREDICTED: Homo sapiens BCL6 transcription repressor (BCL6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCL6 (604)
Length:
9377
CDS:
6180..8300

Additional Resources:

NCBI RefSeq record:
XM_005247694.4
NBCI Gene record:
BCL6 (604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247694.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235663 TGTGCCACAGCAATATCTATT pLKO_005 6937 CDS 100% 13.200 18.480 N BCL6 n/a
2 TRCN0000235666 ACTGCGTTAAAGGCTCGATTT pLKO_005 8845 3UTR 100% 10.800 15.120 N BCL6 n/a
3 TRCN0000013604 CCGGCTCAATAACATCGTTAA pLKO.1 7511 CDS 100% 10.800 15.120 N BCL6 n/a
4 TRCN0000084657 TGAGCAGTTTAGAGCCCATAA pLKO.1 6299 CDS 100% 10.800 8.640 N Bcl6 n/a
5 TRCN0000013603 CCCATGATGTAGTGCCTCTTT pLKO.1 8382 3UTR 100% 4.950 3.960 N BCL6 n/a
6 TRCN0000235667 ACAAGCCAGCCGGCTCAATAA pLKO_005 7502 CDS 100% 13.200 9.240 N BCL6 n/a
7 TRCN0000321365 GATGTTCTTCTCAACCTTAAT pLKO_005 6228 CDS 100% 13.200 9.240 N Bcl6 n/a
8 TRCN0000013605 GCCTGTTCTATAGCATCTTTA pLKO.1 6343 CDS 100% 13.200 9.240 N BCL6 n/a
9 TRCN0000235665 TGGACACTTGCCGGAAGTTTA pLKO_005 6532 CDS 100% 13.200 9.240 N BCL6 n/a
10 TRCN0000235664 TGTACACATCTCGGCTCAATT pLKO_005 6448 CDS 100% 13.200 9.240 N BCL6 n/a
11 TRCN0000013606 CCACAGTGACAAACCCTACAA pLKO.1 7799 CDS 100% 4.950 3.465 N BCL6 n/a
12 TRCN0000013607 CCAGTGAAGCAGAGATGGTTT pLKO.1 6559 CDS 100% 4.950 2.970 N BCL6 n/a
13 TRCN0000321438 CAAGCCAGCCGGCTCAATAAT pLKO_005 7503 CDS 100% 15.000 10.500 N Bcl6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247694.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05882 pDONR223 100% 99.9% 99.8% None 478C>T;1161C>T n/a
2 ccsbBroad304_05882 pLX_304 26.9% 99.9% 99.8% V5 478C>T;1161C>T n/a
3 TRCN0000476705 GTACTGAGTATCCACTCCTTGTCA pLX_317 13% 99.9% 99.8% V5 478C>T;1161C>T n/a
4 ccsbBroadEn_14547 pDONR223 52.8% 99.8% 99.5% None 568A>G;940C>A;1120A>T n/a
5 ccsbBroad304_14547 pLX_304 25.1% 98.8% 55.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV