Transcript: Human XM_005248850.3

PREDICTED: Homo sapiens chromosome 6 open reading frame 141 (C6orf141), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C6orf141 (135398)
Length:
3263
CDS:
150..884

Additional Resources:

NCBI RefSeq record:
XM_005248850.3
NBCI Gene record:
C6orf141 (135398)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323217 CCAACTACCCTTCTGTCTTTC pLKO_005 532 CDS 100% 10.800 15.120 N C6orf141 n/a
2 TRCN0000323215 GAGCTCCAACCTGCAATTAAC pLKO_005 953 3UTR 100% 13.200 9.240 N C6orf141 n/a
3 TRCN0000323216 TCGAGGAAATTAAACTCTAAT pLKO_005 865 CDS 100% 13.200 9.240 N C6orf141 n/a
4 TRCN0000350752 TTGTGCGGGTGGAGGATTATC pLKO_005 625 CDS 100% 13.200 9.240 N C6orf141 n/a
5 TRCN0000172997 CCCAACTACCCTTCTGTCTTT pLKO.1 531 CDS 100% 4.950 3.465 N C6orf141 n/a
6 TRCN0000167866 GATTATCAGGTAACACAAGAA pLKO.1 639 CDS 100% 4.950 3.465 N C6orf141 n/a
7 TRCN0000323147 CGAATTTCTGGCAGGCGTGTA pLKO_005 564 CDS 100% 4.050 2.835 N C6orf141 n/a
8 TRCN0000172977 GAAAGTGCTCTTTCTCCTGCA pLKO.1 410 CDS 100% 0.216 0.151 N C6orf141 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13184 pDONR223 100% 96.9% 96.7% None 1_21del;409C>G n/a
2 ccsbBroad304_13184 pLX_304 0% 96.9% 96.7% V5 1_21del;409C>G n/a
3 TRCN0000473035 AGCTCCAAGCTTGAGGCGCTTCGT pLX_317 18.6% 96.9% 96.7% V5 1_21del;409C>G n/a
Download CSV