Transcript: Human XM_005248870.4

PREDICTED: Homo sapiens allograft inflammatory factor 1 (AIF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AIF1 (199)
Length:
674
CDS:
114..674

Additional Resources:

NCBI RefSeq record:
XM_005248870.4
NBCI Gene record:
AIF1 (199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029729 CCTTAATGGAAATGGCGATAT pLKO.1 287 CDS 100% 10.800 7.560 N AIF1 n/a
2 TRCN0000433720 CGTTCAGCTACCCTGACTTTC pLKO_005 610 CDS 100% 10.800 7.560 N AIF1 n/a
3 TRCN0000029731 GCAAGAGATCTGCCATCCTAA pLKO.1 646 CDS 100% 4.950 3.465 N AIF1 n/a
4 TRCN0000029732 CAATTCCTAGACGATCCCAAA pLKO.1 201 CDS 100% 4.050 2.835 N AIF1 n/a
5 TRCN0000029730 CCTGAAACGAATGCTGGAGAA pLKO.1 518 CDS 100% 4.050 2.835 N AIF1 n/a
6 TRCN0000192018 CAAAGAGAAATACATGGAGTT pLKO.1 263 CDS 100% 4.050 2.430 N Aif1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00043 pDONR223 100% 56.3% 56.3% None 196_393del;558_559ins81 n/a
2 ccsbBroad304_00043 pLX_304 0% 56.3% 56.3% V5 196_393del;558_559ins81 n/a
3 TRCN0000473009 AACGTATCCTATGGGACCTCAGTG pLX_317 100% 56.3% 56.3% V5 196_393del;558_559ins81 n/a
Download CSV