Transcript: Human XM_005248986.3

PREDICTED: Homo sapiens ring finger protein 144B (RNF144B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF144B (255488)
Length:
4697
CDS:
339..1145

Additional Resources:

NCBI RefSeq record:
XM_005248986.3
NBCI Gene record:
RNF144B (255488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430512 ATCCTCATAGGAGCTATAAAG pLKO_005 1615 3UTR 100% 13.200 18.480 N RNF144B n/a
2 TRCN0000034151 GTGGACCAGTTTCAACTTTAT pLKO.1 522 CDS 100% 13.200 18.480 N RNF144B n/a
3 TRCN0000437025 TCGTAGGCTTGGGCATCATTG pLKO_005 1018 CDS 100% 10.800 15.120 N RNF144B n/a
4 TRCN0000034149 CGGGTTTATATCGAACGCAAT pLKO.1 822 CDS 100% 4.050 5.670 N RNF144B n/a
5 TRCN0000412613 TTGTCATTGTTGGCAACATAC pLKO_005 1493 3UTR 100% 10.800 7.560 N RNF144B n/a
6 TRCN0000034150 CCCATGTATAATCTGTTGTGT pLKO.1 1073 CDS 100% 3.000 2.100 N RNF144B n/a
7 TRCN0000034152 CCACTCAAGAGCATCAGTGAT pLKO.1 968 CDS 100% 4.950 2.970 N RNF144B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13471 pDONR223 100% 87.8% 88.1% None (many diffs) n/a
2 ccsbBroad304_13471 pLX_304 0% 87.8% 88.1% V5 (many diffs) n/a
3 TRCN0000466705 GCCCTGCAGACGTGCTATTAGCGG pLX_317 37.9% 87.8% 88.1% V5 (many diffs) n/a
Download CSV