Transcript: Human XM_005250233.5

PREDICTED: Homo sapiens kelch domain containing 10 (KLHDC10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHDC10 (23008)
Length:
6313
CDS:
113..1354

Additional Resources:

NCBI RefSeq record:
XM_005250233.5
NBCI Gene record:
KLHDC10 (23008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250233.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245593 GAGGTACAACCGGCTATATTT pLKO_005 693 CDS 100% 15.000 21.000 N KLHDC10 n/a
2 TRCN0000167704 GCAGATAATACCAACCTATAT pLKO.1 320 CDS 100% 13.200 18.480 N KLHDC10 n/a
3 TRCN0000245594 GCAGATAATACCAACCTATAT pLKO_005 320 CDS 100% 13.200 18.480 N KLHDC10 n/a
4 TRCN0000245592 GAAGAAACCCAGTCGTATATA pLKO_005 628 CDS 100% 15.000 10.500 N KLHDC10 n/a
5 TRCN0000245595 CCCTAAGTATGTGGTGTAAAT pLKO_005 2231 3UTR 100% 13.200 9.240 N KLHDC10 n/a
6 TRCN0000245596 TACTTCCTGGACAGCATATTC pLKO_005 859 CDS 100% 13.200 9.240 N KLHDC10 n/a
7 TRCN0000172833 GCAGACTTTCCAATGGGTGAA pLKO.1 1069 CDS 100% 4.050 2.835 N KLHDC10 n/a
8 TRCN0000215407 GTCACAGTTGTGTTCAAATTA pLKO.1 978 CDS 100% 15.000 10.500 N Klhdc10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250233.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07826 pDONR223 100% 93.3% 93.2% None 164_165ins87;215A>G n/a
2 ccsbBroad304_07826 pLX_304 0% 93.3% 93.2% V5 164_165ins87;215A>G n/a
3 TRCN0000481569 TATTTCAATAACAGGATGTTAGGC pLX_317 32.8% 93.3% 93.2% V5 164_165ins87;215A>G n/a
Download CSV