Transcript: Human XM_005251848.2

PREDICTED: Homo sapiens ATP/GTP binding protein 1 (AGTPBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGTPBP1 (23287)
Length:
4663
CDS:
413..4093

Additional Resources:

NCBI RefSeq record:
XM_005251848.2
NBCI Gene record:
AGTPBP1 (23287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251848.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275417 AGCAATGCCAGAGTCTAATTA pLKO_005 3091 CDS 100% 15.000 21.000 N AGTPBP1 n/a
2 TRCN0000073904 CCGGATTTACATCCTACAATT pLKO.1 3371 CDS 100% 13.200 18.480 N AGTPBP1 n/a
3 TRCN0000073905 CCGAATTACATTGCAGAATAT pLKO.1 2017 CDS 100% 13.200 10.560 N AGTPBP1 n/a
4 TRCN0000285392 TATACCATGGAGAGTACTTTA pLKO_005 3707 CDS 100% 13.200 10.560 N AGTPBP1 n/a
5 TRCN0000073906 GCCTCCATTCAAAGAGCCTAT pLKO.1 2380 CDS 100% 4.050 3.240 N AGTPBP1 n/a
6 TRCN0000275476 CATGACCCAGACCTCTATATT pLKO_005 2285 CDS 100% 15.000 10.500 N AGTPBP1 n/a
7 TRCN0000275418 TTTATCTCCCTATGGTTATAT pLKO_005 4370 3UTR 100% 15.000 10.500 N AGTPBP1 n/a
8 TRCN0000275475 AGATTGGCACCGCCATGATAA pLKO_005 1174 CDS 100% 13.200 9.240 N AGTPBP1 n/a
9 TRCN0000073907 CCTCCATTCAAAGAGCCTATT pLKO.1 2381 CDS 100% 10.800 7.560 N AGTPBP1 n/a
10 TRCN0000073903 CCTGAGTATCATTGCATGAAT pLKO.1 4348 3UTR 100% 5.625 3.938 N AGTPBP1 n/a
11 TRCN0000031456 CCAGACCTCTATATTGAGATT pLKO.1 2291 CDS 100% 4.950 3.465 N Agtpbp1 n/a
12 TRCN0000354231 CCAGACCTCTATATTGAGATT pLKO_005 2291 CDS 100% 4.950 3.465 N Agtpbp1 n/a
13 TRCN0000031458 CGGCATAGAAACATGCTCATT pLKO.1 1196 CDS 100% 4.950 3.465 N Agtpbp1 n/a
14 TRCN0000332562 CGGCATAGAAACATGCTCATT pLKO_005 1196 CDS 100% 4.950 3.465 N Agtpbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251848.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02745 pDONR223 100% 96.7% 96.7% None 910_1029del n/a
2 ccsbBroad304_02745 pLX_304 0% 96.7% 96.7% V5 910_1029del n/a
3 TRCN0000467358 GCAACTTTACACCAATTTTGTATC pLX_317 11.7% 96.7% 96.7% V5 910_1029del n/a
Download CSV